Article

ISSN 0006-2979, Biochemistry (Moscow), 2024, Vol. 89, No. 5, pp. 883-903 © Pleiades Publishing, Ltd., 2024.

883

Molecular Changes in Immunological Characteristics

of Bone Marrow Multipotent Mesenchymal Stromal Cells

in Lymphoid Neoplasia

Nataliya A. Petinati

1,a

, Aleksandra V. Sadovskaya

1,2#

, Natalia V. Sats

Nikolai M. Kapranov

, Yulia O. Davydova

, Ekaterina A. Fastova

Aminat U. Magomedova

, Anastasia N. Vasilyeva

, Olga A. Aleshina

Georgiy P. Arapidi

3,4,5

, Viktoria O. Shender

3,4

, Igor P. Smirnov

, Olga V. Pobeguts

Maria A. Lagarkova

, Nina I. Drize

, and Elena N. Parovichnikova

National Medical Research Center for Hematology, Ministry of Health of the Russian Federation,

125167 Moscow, Russia

Lomonosov Moscow State University, 119991 Moscow, Russia

Lopukhin Federal Research and Clinical Center of Physical-Chemical Medicine,

Federal Medical Biological Agency, 119435 Moscow, Russia

Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences,

117997 Moscow, Russia

Moscow Institute of Physics and Technology, 141700 Dolgoprudny, Russia

e-mail: loel@mail.ru

Received September 15, 2023

Revised November 22, 2023

Accepted November 23, 2023

Abstract— Immune system and bone marrow stromal cells play an important role in maintaining normal he-

matopoiesis. Lymphoid neoplasia disturbs not only development of immune cells, but other immune response

mechanisms as well. Multipotent mesenchymal stromal cells (MSCs) of the bone marrow are involved in immune

response regulation through both intercellular interactions and secretion of various cytokines. In hematological

malignancies, the bone marrow stromal microenvironment, including MSCs, is altered. Aim of this study was to

describe the differences of MSCs’ immunological function in the patients with acute lymphoblastic leukemia (ALL)

and diffuse large B-cell lymphoma (DLBCL). In ALL, malignant cells arise from the early precursor cells localized

in bone marrow, while in DLBCL they arise from more differentiated B-cells. In this study, only the DLBCL patients

without bone marrow involvement were included. Growth parameters, surface marker expression, genes of in-

terest expression, and secretion pattern of bone marrow MSCs from the patients with ALL and DLBCL at the onset

of the disease and in remission were studied. MSCs from the healthy donors of corresponding ages were used as

controls. It has been shown that concentration of MSCs in the bone marrow of the patients with ALL is reduced at

the onset of the disease and is restored upon reaching remission; in the patients with DLBCL this parameter does

not change. Proliferative capacity of MSCs did not change in the patients with ALL; however, the cells of the DLBCL

patients both at the onset and in remission proliferated significantly faster than those from the donors. Expression

of the membrane surface markers and expression of the genes important for differentiation, immunological status

maintenance, and cytokine secretion differed significantly in the MSCs of the patients from those of the healthy

donors and depended on nosology of the disease. Secretomes of the MSCs varied greatly; a number of proteins

associated with immune response regulation, differentiation, and maintenance of hematopoietic stem cells were

Abbreviations: ALL, acute lymphoblastic leukemia; Ct,number of cycles required to reach the probe fluorescence threshold

in PCR; DLBCL,diffuse large B-cell lymphoma; HSCs,hematopoietic stem cells; MFI,mean fluorescence intensity; MSCs,mul-

tipotent mesenchymal stromal cells; REL,relative expression level.

* To whom correspondence should be addressed.

# These authors contributed equally to this work.

PETINATI et al.884

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

depleted in the secretomes of the cells from the patients. Lymphoid neoplasia leads to dramatic changes in the

functional immunological status of MSCs.

DOI: 10.1134/S0006297924050092

Keywords: multipotent mesenchymal stromal cells, acute lymphoblastic leukemia, diffuse large B-cell lymphoma,

gene expression, protein secretion

INTRODUCTION

Bone marrow is responsible for production and

maintenance of blood cell populations, including im-

mune cells, throughout the human life. In addition, it

acts as an important lymphoid organ, housing many

types of mature lymphocytes including B cells, T cells,

natural killer T cells, and innate immune cells [1].

Inbone marrow, lymphoid cells interact with the stro-

mal microenvironment and are involved in regulation

of hematopoiesis and immune response. Hematopoi-

etic stem cells (HSCs) reside in the specialized niches

that maintain them for lifelong blood cell production.

Niches also provide homing and survival of HSCs, reg-

ulate their dormant state, self-renewal, differentiation,

and proliferation. Many cell types are involved in for-

mation and functioning of these niches [2]. Main niche

components include mesenchymal stem cells, which

differentiate into numerous other stromal cells that

make up the niche, keep HSCs in it, and take part in

immune responses in the bone marrow [3].

B-cell lymphoproliferative disorders, which in-

clude multiple myeloma, Hodgkin’s lymphoma, and

chronic lymphocytic leukemia (CLL), as well as pre-

cursor conditions such as monoclonal B-cell lympho-

cytosis, are pathologies characterized by uncontrolled

growth of B-lymphocytes [4]. Lymphoproliferative dis-

orders can occur either in the lymphatic tissues (as

in lymphoma) or in the bone marrow (as in CLL and

multiple myeloma). Course of the disease and treat-

ment vary widely depending on the type of neoplasia

and other individual factors; however, even extramed-

ullary tumors affect the bone marrow stromal micro-

environment [5]. In addition, the bone marrow stroma

can be strongly affected by chronic viral infections.

For example, the CXCL12-abundant reticular cells (CAR

cells) die in the mice with chronic lymphocytic chori-

omeningitis due to production of IFN-α and IFN-γ by

the virus-specific CD8

T cells [6]. Chronic viral infec-

tions are associated with hematopoiesis suppression,

bone marrow failure, and depletion of the HSC pool

[7,8]. Combination of functional analysis with 3D mi-

croscopy demonstrated that chronic infection with

lymphocytic choriomeningitis virus leads to the death

of most mesenchymal CAR cells and pro-inflammatory

transcriptional remodeling of the remaining ones. This

causes long-term functional defects and reduced com-

petitive repopulation ability of HSCs. Bone marrow

immunopathology is caused by the virus-specific acti-

vated CD8

T cells that accumulate in the bone mar-

row through the interferon-dependent mechanisms.

Combined inhibition of the IFN type I and type  II

pathways by antibodies completely prevents CAR cell

degeneration and protects HSCs from chronic dysfunc-

tion. Thus, viral infections and subsequent immune

response have a lasting effect on the bone marrow ho-

meostasis, permanently reducing repopulation ability

of HSCs and disrupting secretion of the key stromal cy-

tokines that support hematopoiesis [9].

Acute lymphoblastic leukemia (ALL) is a neopla-

sia arising from early progenitors of B-cells(B-ALL) or

T-cells (T-ALL). The disease is characterized by uncon-

trolled proliferation of lymphoid progenitors in the

bone marrow and consequent appearance of large

numbers of immature lymphocytes, disrupting normal

hematopoiesis. B-ALL is considered a genetic disease,

but increasing evidence points to the ability of the

bone marrow microenvironment to significantly con-

tribute to maintenance, progression, response to treat-

ment, and possibly development of the disease, regard-

less of the presence of specific genetic abnormalities

in hematopoietic cells [10]. There is a large body of

evidence suggesting that B-ALL cells can modify the

bone marrow microenvironment creating conditions

conducive to the survival of malignant cells during

chemotherapy, leading to the disease recurrence. Leu-

kemic cells interact with components of the bone mar-

row microenvironment, including multipotent mesen-

chymal stromal cells(MSCs) [11]. Studying interactions

between the bone marrow microenvironment and

ALL cells has led to the discovery of potential thera-

peutic targets that include cytokines/chemokines and

their receptors, adhesion molecules, signal transduc-

tion pathways, and hypoxia-associated proteins [12].

Complex interactions between the leukemic cells and

components of the bone marrow microenvironment

lead to the involvement of MSCs in the suppression of

antitumor response, since these cells secrete cytokines

such as transforming growth factor-β (TGF-β) and he-

patocyte growth factor (HGF), which mediate suppres-

sion of T-cells [13].

Diffuse large B-cell lymphoma (DLBCL) is a hetero-

geneous group of diseases that differ in histological, im-

munohistochemical, and molecular characteristics[14].

LYMPHOID NEOPLASIA 885

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

In DLBCL, histological or molecular methods reveal

damage to the bone marrow only in 10-25% of pa-

tients [15]. It is believed that in the remaining patients

bone marrow is not involved in the malignant process.

However, bone marrow stromal progenitor cells in the

DLBCL patients without bone marrow involvement

are altered [16]. These changes cannot be attributed to

the contact interaction with tumor cells, as occurs in

leukemia [17, 18]. Many tumors secrete cytokines and

chemokines [19, 20], moreover, presence of a tumor

can be considered an inflammatory process [21, 22].

Inflammation is associated with active release of mul-

tiple factors that can activate cells of the bone marrow

stromal microenvironment, in particular MSCs [23].

MSCs activated by IL-1β, TNF, and IFN-γ secrete inhib-

itors and activators of the inflammatory process [24].

The aim of the study was to analyze the effect of

lymphoid neoplasia from early progenitor cells in di-

rect contact with the bone marrow stroma (ALL) and

more mature cells located exclusively extramedullary

(DLBCL) on immunological function of MSCs.

MATERIALS AND METHODS

Patient and donor bone marrow samples. Pa-

tient and donor samples were obtained in accordance

with the Declaration of Helsinki after the written in-

formed consent. The study was approved by the ethics

committee of the Federal State Budgetary Institution

National Medical Research Center for Hematology of

the Ministry of Health of the Russian Federation, pro-

tocol No.171 dated April27, 2023.

The work was performed with MSCs isolated from

the bone marrow of patients with ALL and DLBCL;

MSCs from the bone marrow of healthy donors were

used as controls. To account for the age difference,

two different donor groups were age-matched with

the patients with ALL and DLBCL. As such, the studied

parameters were normalized to the value of the corre-

sponding donor group median. Data on the number of

samples, patients, and healthy donors are presented

inTable1.

MSCs cultivation. Bone marrow was obtained

from the patients during diagnostic punctures and

from the hematopoietic stem cells donors during ex-

fusions after informed consent. To prevent clotting,

2-7 ml of bone marrow were placed in sterile tubes

with 1 ml of heparin (50  units/ml). The bone marrow

samples were diluted 2-fold with an α-MEM (ICN, Cana-

da) containing 0.2% methylcellulose (1500 cP, Sigma-Al-

drich, USA) and left for 40 min at room temperature.

Supernatant was collected and precipitated by centrif-

ugation at 450g for 10 min. Number of nuclear cells

was determined by counting after staining with gen-

tian violet solution (1% solution in 3% acetic acid) in a

Goryaev chamber. Cells (3×10

) were placed in a flask

with a bottom area of 25 cm

(Corning-Costar, USA)

Table 1. Characteristics of patients and donors

Diagnosis Group

Total number

of patients

Sex

Number

of patients

Age, years

Median

age, years

ALL

onset 31

male 15 19-72 29

female 16 18-55 31

remission 14

male 5 19-55 24

female 9 18-55 30

DLBCL

onset 40

male 14 30-78 48

female 26 34-79 60

remission 40

male 14 30-78 48

female 26 34-79 60

Healthy

donors

ALL 56

male 30

18-48 27

female 26

DLBCL 30

male 10

30-78 54

female 20

PETINATI et al.886

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

in 5 ml of complete α-MEM nutrient medium (ICN,

Canada) supplemented with 10% fetal bovine serum

(FBS) (Hyclone, USA), 2 mM L-glutamine (ICN, Cana-

da), 100 U/ml penicillin (Sintez, Russia), and 5  µg/ml

streptomycin (BioPharmGarant, Russia). MSCs were

cultivated at 37°C and 5% CO

. Culture medium was

changed twice a week. After reaching confluency,

the cells were passaged. To do this, the cells were

washed twice with 5ml of Versen’s solution and once

with 0.25 ml of 0.25% trypsin solution (PanEco, Rus-

sia). 0.25 ml of trypsin solution was added, and flasks

were left at room temperature until the cells detached

from the surface. The cells were resuspended in 1 ml

of the medium with FBS, and counted in 0.2% trypan

blue solution (Sigma-Aldrich) to determine their num-

ber and viability (trypan blue only stains dead cells).

During passage, 10

cells were seeded in a flask with a

bottom area of 25 cm

in 5 ml of the medium. Cultures

were maintained for 4 passages.

The time to P0 was defined as the number of days

from seeding bone marrow to reaching confluence for

the first time.

Calculation of cumulative cell production. Cu-

mulative cell production over 3 passages was calculat-

ed using the formula (1):

sum

= N0 + N0 · 

200000

 + N1 · 

200000

 + N2 · 

200000

 , (1)

where N0, N1, N2, and N3 are number of the cells re-

moved from 2 culture flasks at passages 0, 1, 2, and 3,

respectively.

Surface marker expression analysis by flow cy-

tometry. Surface phenotype of MSCs was studied at the

2nd passage by flow cytometry. After removing MSCs

from the flask, they were washed twice with CellWash

solution (BD Biosciences, USA) and then 2×10

cells

were incubated for 20 min in the dark with antibod-

ies. The antibody panels were as follows: 1) PE-labeled

anti-CD90 (5E10, BD Pharmingen, USA), FITC-labeled

anti-HLA-ABC (FN50, BioLegend, USA) and APC-labeled

anti-HLA-DR (L243, BioLegend); 2) anti-CD105, labeled

with FITC (43A3, BioLegend), anti-CD54, labeled with

APC (HA58, BioLegend), anti-CD146 PE-labeled (P1H12,

BD Pharmingen, USA); 3) PE-labeled anti-CD73 (AD2,

BD Pharmingen, USA). The analysis was performed

using a CytoFLEX flow cytometer (Beckman Coulter,

USA), data were analyzed with Kaluza Analysis 2.1

(Beckman Coulter). MSC population was determined

by forward and side light scattering. Mean fluores-

cence intensity (MFI) was assessed in APC, FITC, and

PE channels.

Relative level of gene expression analysis.

RNA isolation. To isolate RNA, the cells of the first

passage (10

-4.5×10

cells) were centrifuged at 300g.

The pellet was washed with 1 ml of phosphate buffer

and centrifuged at 300g. 400  µl of TriZol (Ambion by

Life Technologies, USA) was added to the pellet. Sam-

ples with TriZol were frozen at –70°C. After thawing,

120 µl of chloroform was added to the samples, after

which they were shaken, incubated for 2 min at room

temperature, and centrifuged for 15 min at 13,500g

and 4°C in a Centrifuge 5424 R (Eppendorf, Germany).

The resulting upper phase was transferred into new

tubes. 400 µl of isopropanol was added, the samples

were incubated for 10 min at room temperature and

centrifuged for 10 min at 13,500g and 4°C. The pellet

was washed with 1 ml of 75% ethanol, vortexed, and

centrifuged for 5 min at 13,500g at 4°C. The pellet

was left to dry for 5  min at room temperature. Next,

100 µl of DEPC-treated water was added to the pellet

and left for 30 min on ice for it to dissolve. After vor-

texing, 1 µl was taken to measure the amount of ex-

tracted RNA. The measurement was carried out with

a NanoDrop One spectrophotometer (Thermo Fisher

Scientific, USA) at a wavelength of 260 nm, RNA pu-

rity was determined by the ratio of 260/280 nm (it

should be in the range of 1.8-2.0). To the remaining

99 μl of the RNA solution, 10  μl of 3  M sodium acetate

and 250μl of 96% ethanol were added. Samples were

stored at –20°C.

cDNA synthesis. RNA in a mixture of ethanol and

sodium acetate was centrifuged for 10min at 13,500g

and 4°C. After that, the pellet was washed with 1 ml of

75% ethanol, mixed on a vortex, and centrifuged for

5 min at 13,500g and 4°C. The pellet was left to dry for

5 min at room temperature. 1  µl of DEPC-treated wa-

ter was added per 1 µg of RNA and the samples were

left on ice for 30 min for dissolution. Primers for re-

verse transcription (T13 primers and random hex-

amers) were annealed: 2 µl of RNA solution, 1.25  µl

of each primer (40 pmol/µl) and 5.5  µl of DEPC-treated

water were mixed, incubated in a Tertsik amplifier

(DNA-Technology) for 10  min at 70°C and 10 min at4°C.

After that, 15 μl of the reverse transcription mix

(5.5 µl milliQ water, 5 µl 5X M-MLV reversease buffer

(Promega, USA), 2.5 µl dNTPs mix, 1  µl each RNAsin

(Promega) and M-MLV reversease (Promega)) was add-

ed, and the samples were incubated in a Tertsik ampli-

fier at 42°C for 1 h. 75  μl of milliQ water were added.

The samples were stored at –20°C.

Real-time PCR. Real-time PCR in Taq-man modifi-

cation was performed with an AbiPrism Real Time PCR

System 7500 (Thermo Fisher Scientific) in a 96-well

plate; the reaction volume was 25µl. Each sample was

analyzed in triplicate; a positive control (a reference

mixture of cDNA from 117 donors) was used to assess

the quality of the reaction and correlate the results

of different PCRs, and a negative control was includ-

ed (water was added instead of cDNA). Sequences of

primers and probes are presented in Table  2. PCR re-

agents were mixed into a master mix (12.8 µl milliQ

water, 3.5 µl 25 mM  MgCl

(Thermo Fisher Scientific),

LYMPHOID NEOPLASIA 887

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Table 2. Primers and probes sequences

Gene Purpose Sequence

BACT forward primer CAACCGCGAGAAGATGACC

BACT reverse primer CAGAGGCGTACAGGGATAGC

BACT probe ROX-AGACCTTCAACACCCCAGCCATGTACG-BHQ2

GAPDH forward primer GGTGAAGGTCGGAGTCAACG

GAPDH reverse primer TGGGTGGAATCATATTGGAACA

GAPDH probe ROX-CTCTGGTAAAGTGGATATTGTTGCCATCA-BHQ2

VEGFA forward primer AGGCGAGGCAGCTTGAGTTA

VEGFA reverse primer ACCCTGAGGGAGGCTCCTT

VEGFA probe FAM-CCTCGGCTTGTCACATCTGCAAGTACGT-RTQ1

FGF2 forward primer GAAGAGCGACCCTCACATCAAG

FGF2 reverse primer TCCGTAACACATTTAGAAGCCAGTA

FGF2 probe FAM-TCATAGCCAGGTAACGGTTAGCACACACTCCT-RTQ1

IL6 forward primer ACCTGAACCTTCCAAAGATG

IL6 reverse primer CTCCAAAAGACCAGTGATGA

IL6 probe FAM-ATTCAATGAGGAGACTTGCCTGGTG-RTQ1

IL8 forward primer ACCATCTCACTGTGTGTAAAC

IL8 reverse primer GTTTGGAGTATGTCTTTATGC

IL8 probe FAM-CAGTTTTGCCAAGGAGTGCTAAAG-RTQ1

PDGFRB forward primer CTCCCTTATCATCCTCATCA

PDGFRB reverse primer TCCACGTAGATGTACTCATG

PDGFRB probe FAM-TCACAGACTCAATCACCTTCCATC-RTQ1

SPP1 forward primer ATAGTGTGGTTTATGGACTGAG

SPP1 reverse primer ATTCAACTCCTCGCTTTCC

SPP1 probe FAM-CCAGTACCCTGATGCTACAGACGAG-RTQ1

BGLAP forward primer GCAGCGAGGTAGTGAAGAG

BGLAP reverse primer GAAAGCCGATGTGGTCAG

BGLAP probe FAM-CTCCCAGCCATTGATACAGGTAGC-RTQ1

PPARG forward primer TACTGTCGGTTTCAGAAATGC

PPARG reverse primer CAACAGCTTCTCCTTCTCG

PPARG probe FAM-CCATCAGGTTTGGGCGGATGCC-RTQ1

FGFR1 forward primer CAGAATTGGAGGCTACAAGG

PETINATI et al.888

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Table 2 (cont.)

Gene Purpose Sequence

FGFR1 reverse primer TGATGCTGCCGTACTCATTC

FGFR1 probe FAM-CATCATAATGGACTCTGTGGTGC-RTQ1

FGFR2 forward primer CTCATTATGGAAAGTGTGGTC

FGFR2 reverse primer TGGGCCGGTGAGGCGATC

FGFR2 probe FAM-CAGGTGGTACGTGTGATTGATGGA-RTQ1

SOX9 forward primer AGCAAGACGCTGGGCAAG

SOX9 reverse primer GTTCTTCACCGACTTCCTC

SOX9 probe FAM-CTGGAGACTTCTGAACGAGAGC-RTQ1

SDF1 forward primer CTACAGATGCCCATGCCGAT

SDF1 reverse primer TAGCTTCGGGTCAATGCACA

SDF1 probe FAM-CAGTTTGGAGTGTTGAGAATTTTGAG-RTQ1

TGFB1 forward primer TGCGTCTGCTGAGGCTCAA

TGFB1 reverse primer CGGTGACATCAAAAGATAACC

TGFB1 probe FAM-AGGAATTGTTGCTGTATTTCTGGTAC-RTQ1

ICAM1 forward primer GCAATGTGCAAGAAGATAGC

ICAM1 reverse primer CTCCACCTGGCAGCGTAG

ICAM1 probe ROX-CACGGTGAGGAAGGTTTTAGCTGTT-RTQ2

2.5 µl 2.5  mM dNTPs mix, 2.5  µl 10X SmarTaq buffer

(Promega), 1 µl of forward and reverse primers each

(10 pmol/µl), 0.5  µl fluorescent probe (10 pmol/µl),

0.2  µl Taq polymerase (Promega) per reaction). 72 µl of

the master mix were placed into wells of a 96-well PCR

plate and 3 µl of the cDNA solution was added. The

samples were mixed and divided into 3 wells (25 µl

per well) to obtain triplicates. PCR started with 10-min

incubation at 95°C to activate the polymerase; 40 cy-

cles of PCR were performed for the BACT and GAPDH

genes, and 45 cycles for the remaining genes. Cycle pa-

rameters: 15 s at 95°C +  40 s at 60°C.

Calculation of relative gene expression level.

Relative expression level (REL) of genes was calculat-

ed using the modified ΔΔCt method [25]. The mean Ct

of three replicates was used for calculations. Ct is the

number of cycles required to reach the probe fluores-

cence threshold in PCR. For each gene, ΔCt was calcu-

lated using the formula(2):

ΔCt = Ct

sample

– Ct

control

. (2)

The RELs of the housekeeping genes (RELhk) –

BACT and GAPDH– were calculated using the formu-

la(3):

REL

= 2

–ΔCt

. (3)

Next, the sample normalization factor (NF) was

calculated using the formula (4):

NF =

√

REL

BACT

REL

GAPDH

. (4)

RELs for the genes of interest were calculated us-

ing the formula (5):

REL = 

−ΔCt

)

 . (5)

Secretome analysis. Preparation of MSCs con-

ditioned medium. MSCs at the passages 2-3 were

seeded at 4×10

cells per cm

in T175 flasks (Costar,

USA). After the cells reached confluence (3-4 days),

the flasks were washed 5 times with phosphate buffer

LYMPHOID NEOPLASIA 889

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

without Ca

/Mg

(Invitrogen, USA). The cells were

then cultured for 24 h in RPMI1640 medium without

serum and phenol red (HyClone). The conditioned me-

dium was centrifuged at 400g and frozen at –70°C.

Sample preparation for analysis. A protease in-

hibitor cocktail (Halt Protease Inhibitor Cocktail, Ther-

mo Fisher Scientific) was added to each sample, which

were then centrifuged at 1500g for 10  min to remove

debris. Supernatants were immediately frozen and ly-

ophilized to reduce volume. The lyophilized samples

were resuspended for 30 min in a buffer containing

6 M Gd-HCl, 10  mM  Tris-HCl (pH 8) and 2  mM DTT.

Toprecipitate the insoluble fraction, the solutions were

centrifuged at 16,000g for 10min at 4°C. Samples were

concentrated using a centrifuge filter (Corning Spin-X

UF6, Sigma-Aldrich) to replace the buffer. Buffer (8 M

urea, 2 M thiourea, 10  mM Tris-HCl (pH  = 8)) was add-

ed to the concentrated samples at a ratio of 1: 3 and

incubated at room temperature for 30 min. Disulfide

bonds were reduced with 5 mM  DTT at room tempera-

ture for 40  min and next alkylated with 10 mM iodoac-

etamide in the dark at room temperature for 20 min.

Alkylated samples were diluted by adding 50 mM

HCO

solution at a ratio of 1 :  4 followed by tryp-

sin addition (0.01 μg per 1 μg of protein) and incu-

bation at 37°C for 14 h. The reaction was stopped by

adding formic acid to a final concentration of 5%. The

peptides were desalted using Discovery DSC-18 tubes

(1 ml, 50  mg) (Sigma-Aldrich), dried under vacuum,

and stored at –80°C before analysis. Prior to LC-MS/MS,

samples were redissolved in 5% acetonitrile with 0.1%

trifluoroacetic acid and sonicated.

LC-MS/MS analysis. Analysis was performed us-

ing an Orbitrap Q Exactive HF-X mass spectrometer

equipped with a nano-ESI source and a high pressure

nanoflow chromatograph (UPLC Ultimate 3000) with a

C-18 (100µm) reverse phase column. ×300mm).

Bioinformatic processing of mass spectrome-

try data. Raw data from the mass spectrometer were

converted into .mgf files using MSConvert (ProteoWiz-

ard Software Foundation, USA) with the parameters

“--mgf --filter pickPicking true [1,2]”. To identify pro-

teins, a search was carried out using MASCOT (ver-

sion 2.5.1, Matrix Science Ltd., UK) and X!Tandem

(ALANINE, 2017.02.01, 2017.02.01, The Global Proteome

Machine Organization) in the UniProt human protein

database with concatenated backtrap dataset. Permis-

sible masses of the precursor and fragment were set to

20 ppm and 0.04  Da, respectively. Database search pa-

rameters included the following: tryptic digestion with

one possible gap [26], static modification for urea meth-

yl (C), and dynamic modifications for oxidation (M).

For X!Tandem, parameters were chosen that allowed

to quickly check for the acetylation of the N-terminal

residue of the protein, the loss of ammonia from the

N-terminal glutamine and water from the N-terminal

glutamic acid. The resulting files were processed in

Scaffold 5 (version 5.1.0). An algorithm for estimating

the local false discovery rate (FDR) with standard

grouping of proteins was used. To assess the hits of

peptides and proteins, FDR =  0.05 was chosen for both.

The samples annotated in the Swiss-Prot database were

marked as preferred.

Statistical analysis. Data sets are presented as in-

dividual values with indicated median. For each data

set, a normality test was performed using the Shapiro–

Wilk test (at p  < 0.05, the distribution was taken to be

different from normal). Significance of differences was

analyzed using Mann–Whitney test for non-normal

distributions. Differences were considered statistical-

ly significant at p  < 0.05. Statistical analysis was per-

formed using GraphPad Prism8.03.

RESULTS

Under the influence of lymphoid neoplasia, the

characteristics of MSCs change. Hematopoietic pro-

genitors that initiate tumor development in ALL and

DLBCL differ in the stage of differentiation: in ALL,

early bone marrow progenitors undergo tumor trans-

formation, while in DLBCL, it happens to more differ-

entiated B cells outside the bone marrow. MSCs only

from DLBCL patients without bone marrow involve-

ment were included in this study.

MSCs growth characteristics. Time required for

the MSCs of the patients at the onset of ALL to reach

P0 increased in comparison to the time required for

donor MSCs (p  < 0.0001), which may indirectly reflect

decrease in the number of stromal progenitor cells in

the bone marrow. Upon reaching remission, this pa-

rameter returned to normal. MSCs of the patients with

DLBCL did not differ from those of the healthy do-

nors at the onset of the disease, and in remission they

reached P0 faster than those of the donors (p  = 0.0107).

As a result, the time to P0 was longer in the cells from

the patients with ALL than in the MSCs from the pa-

tients with DLBCL at the onset of the disease (Fig.1a).

In remission, the time to P0 did not differ significantly.

Cumulative cell production of ALL patients’ MSCs

in 3 passages did not differ from that of the healthy

donors. When remission was achieved, total cell pro-

duction of patients with ALL increased significantly

compared to the donors (p  = 0.0419). Cumulative cell

production of the MSCs from the patients with DLBCL

increased in comparison to the donors’ MSCs both at

the onset (p  = 0.0119) and in remission of the disease

(p =  0.0011), and at the onset it was also significantly

higher than at the onset of ALL (Fig.1b).

Thus, we have shown that in ALL, the MSC growth

is suppressed before treatment and returns to nor-

mal in remission, while in DLBCL, on the contrary,

PETINATI et al.890

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Fig. 1. Time to passage 0 (P0)(a) and cumulative cell production in 3 passages(b) of MSCs from patients with ALL and DLBCL

before treatment and in remission normalized to age-matched donor MSCs’ median value. Data are presented as scatterplots

with indicated median. Horizontal red line indicates the median values of healthy donors’ cells.

the MSCs grow more actively than the cells from the

healthy donors. Other studied characteristics of the

MSCs from the patients differed from the donors’ cells

as well.

Membrane surface marker analysis. MSCs from

the bone marrow of the patients with hematological

diseases and the healthy donors differ in the expres-

sion of surface markers.

Mean fluorescence intensity (MFI) of the surface

markers was studied on the cells of 6 patients before

treatment of ALL and 3 in remission of ALL, 9 patients

before treatment and in remission of DLBCL, and 10

donors for each of the patient groups. According to the

International Society for Cellular Therapy (ISCT) crite-

ria, MSCs express CD90, CD105, and CD73 [27]. These

markers were present on all the studied cells, but their

MFIs differed between the groups (Fig. 2, a-c). CD73

MFI was significantly increased on the MSCs from the

patients with ALL before treatment compared to do-

nors’ (Fig. 2c). This parameter did not differ from the

donors neither at the onset nor in the remission of

DLBCL. However, in the remission of DLBCL MFI of

CD73 on the MSCs became significantly higher than it

was before treatment. The MSCs of patients with DLBCL

in remission had increased MFI of CD105 (Fig. 2b). Be-

fore the treatment of ALL, the observed expression

of HLA-ABC on the cells was significantly increased

compared to donors; in remission its MFI decreased

(Fig. 2d). Before the treatment of DLBCL, HLA-ABC

MFI on the cells did not differ from donors’, but in

the remission it significantly increased. The same ef-

fect was observed for the class II histocompatibility

molecules, HLA-DR, in DLBCL (Fig. 2e). Expression of

CD146 on the surface of the MSCs in the patients with

ALL demonstrated an upward trend compared to the

donors (Fig. 2f). In the patients with DLBCL, it did not

differ from the donors before treatment, but signifi-

cantly increased when remission was achieved. There

were no significant differences in the CD54 expression

between the studied groups except for a significant

increase in the patients in remission of DLBCL com-

pared to the donors (Fig. 2g).

Significant changes in the expression of MSC sur-

face markers were detected.

Changes in gene expression of factors import-

ant for immunoregulatory function of MSCs. Pat-

terns of the MSCs gene expression were studied. The

genes selected for analysis encode factors directly in-

volved in the regulation of immune response –  IL6,

IL8, TGFB1; homing and adhesion factors –  SDF1,

ICAM1; growth factors and their receptors –  FGF2,

FGFR1, FGFR2, PDGFRB, VEGFA. Expression pattern

of the MSC differentiation marker genes BGLAP, SPP1,

SOX9, and PPARG was studied as well, since the differ-

entiated descendants of MSCs– osteoblasts, adipocytes,

etc.– participate in immune regulation.

In the patients with ALL, expression of the IL6

gene in MSCs was significantly increased in compari-

son to the donors at the onset of the disease (p  < 0.0001)

and did not normalize after achieving remission

LYMPHOID NEOPLASIA 891

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Fig. 2. Mean fluorescence intensity (MFI) of the surface markers CD 90(a), CD 105 (b), CD 73 (c), HLA-ABC(d), HLA-DR (e),

CD146(f), and CD54(g) on the MSCs of patients with ALL and DLBCL, and healthy donors of corresponding ages. Yaxis shows

MFI fold change relative to the respective median value for the donor cells. Data are normalized to the median values for the

donor groups and presented as scatterplots with marked median.

(p <  0.0001), and in DLBCL it increased after chemo-

therapy compared with the onset of disease (Fig.  3a)

and the healthy donors (p =  0.0018). At the same time,

at the disease onset, IL6 gene expression was higher in

ALL than in DLBCL.

Additionally, at the onset of DLBCL increase in

the IL8 expression level relative to the healthy donors

(p  =  0.0220) was observed, and after treatment REL of

this gene increased even more (Fig. 3b). TGFB1 REL

was lowered in the MSCs of patients at the onset of

ALL compared to donor cells (p  = 0.004) and decreased

even more in remission (p  = 0.0002). In patients with

DLBCL there was also decrease in the REL of this gene

after treatment compared with the onset of the dis-

ease (Fig.3c). In the MSCs of the patients with DLBCL

at the onset and in the remission, the FGF2 REL was

increased compared to donors’ (p  = 0.0121, p =  0.0206,

respectively), at the onset of the disease it was sig-

nificantly higher than in the MSCs of ALL patients

(Fig. 3d). FGF2 receptors differed in their expres-

sion in the patients with ALL and DLBCL (Fig. 3,  e, f).

At the onset of DLBCL, the MSCs had reduced FGFR1

REL (p=0.0166) and increased FGFR2 REL (p  = 0.0017).

In the MSCs of the patients with ALL and DLBCL,

FGFR1 REL was insignificantly reduced at the onset

and remission of the disease, and FGFR2 expression

PETINATI et al.892

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Fig. 3. Relative expression levels of genes IL6(a), IL8(b), TGFB1(c), FGF2(d), FGFR1(e), FGFR2(f), PPARG(g), SOX9(h), SPP1(i),

BGLAP(j), VEGFA(k), SDF1(l), PDGFRB(m), ICAM1(n) in the MSCs of the patients with ALL and DLBCL before treatment and

in remission of the disease, normalized to the median REL of the group of corresponding healthy donor. Yaxis shows mRNA

expression level relative to respective median value for the donor groups. The data are presented as scatterplots with indicated

median. Horizontal red line indicates the median REL of the donor MSCs.

LYMPHOID NEOPLASIA 893

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Fig. 4. Diagram of distribution of the studied proteins secreted by MSCs in ALL and DLBCL at the onset and in remission of the

disease. Number of proteins not secreted by the given group of MSCs but secreted by other groups is indicated.

was significantly elevated in the MSCs of the patients

with DLBCL compared with the donors and signifi-

cantly decreased when remission was achieved; such

changes were not observed in the patients with ALL.

RELs of the MSC differentiation markers differed

between the studied nosologies. REL of the adipose dif-

ferentiation marker PPARG was increased in the MSCs

of the patients with ALL at the onset of the disease

compared to the donors (p  < 0.0001) and remained

elevated in the remission (p  < 0.0001). At both points,

PPARG gene expression in the MSCs was higher in ALL

than in DLBCL (Fig. 3g). The REL of SOX9, a marker

of chondrogenic differentiation, was lower in patients

with ALL at the onset of the disease than in donors

(p  =  0.0049) and lower than in patients with DLBCL at

the onset and remission (Fig.3h).

In DLBCL, expression of some growth factors and

receptors was also altered. In DBBCL remission, the

expression of PDGFRB in MSCs was reduced in com-

parison with the donor MSCs (p  = 0.0006) and with the

onset of the disease (Fig. 3m). SDF1 REL was increased

in DLBCL at the onset and remission of the disease

compared with donors (p  < 0.0001 and p  =  0.0028, re-

spectively, Fig.  3i). In ALL, VEGFA expression was re-

duced at the onset of the disease compared to donors

(p=0.0036), but was restored upon reaching remission

(Fig. 3k). ICAM1 expression increased in ALL remis-

sion compared to the onset of the disease (Fig. 3n).

Thus, the RELs of growth factors, adhesion fac-

tors, and interleukins in the MSCs are altered in ALL

and DLBCL. Changes in the MSC differentiation mark-

er genes demonstrate propensity toward adipogenic

differentiation in ALL.

Secretome. Secretomes of the MSCs of 2 patients

with ALL, 6 patients with DLBCL, and 21 donors were

studied. No significant changes corresponding to the

changes in the gene expression were observed, which

may be due to the small sample number or post-tran-

scriptional modifications. However, there were chang-

es in the secretion levels of the proteins for which

gene expression was not studied in this work.

The patients with ALL are typically much young-

er than the patients with DLBCL, so two groups of do-

nors were used as controls in the secretome analysis.

The number of secretome proteins analyzed is shown

inFig.4.

938 proteins were commonly secreted by the

MSCs of all studied groups. The MSCs from the ALL

patients did not secrete 1444 proteins, while donors’

MSCs did not secrete 1140. DLBCL patients’ MSCs did

not secrete 433 proteins, of which 31 were found in

the secretomes of the MSCs from ALL patients. These

include proteins important for regulation of immune

response– PDGFA, POSTN, LGALS1, and KIT. The MSCs

from both donors and DLBCL patients secreted 800

proteins, while the donor MSCs did not secrete 793 of

the studied proteins.

In ALL, secretion of 70 proteins was increased

before the treatment compared with donors, the most

interesting of which are CXCL12, POSTIN, HLA-DRB,

LGALS1. Additionally, secretion of the proteins regulat-

ing cell migration and related to cytoskeletal organiza-

tion was increased (Fig.5a). Secretion of 15 proteins,

including VCAM1, CSF1, CTGF, ADAMTS1, was reduced.

Those proteins are involved in vesicular transport and

extracellular matrix organization (Fig. 5b).

After achieving remission of ALL, secretion of the

proteins associated with the immune response by the

MSCs changes (Fig. 5,  c, d). Compared to the onset of

the disease, secretion of the proteins involved in the

functioning of chemokines and cytokines, vesicular

transport, MSC differentiation, etc. increased. At the

same time, other proteins involved in the same sig-

naling pathways could decrease. Secretion of 62 pro-

teins was increased relative to the donors, including

PTMA, DCD, LIMCH1, and POSTIN, and secretion of 80

proteins was decreased, including VCAM1, LTBP1, C3,

ANXA1, IGFBP-1, -3, and -6; LGALS1, ENO1.

PETINATI et al.894

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Fig. 5. Enrichment analysis of the signaling pathways with GO database. The most important signaling pathways, components

of which were differentially found in the secretomes of MSCs from the patients with ALL and donors, are presented. Only sig-

nificant changes (p<0.05) were taken into account. Histograms represent -log10 FDR (false discovery rate) values. a)Signaling

pathways components of which were upregulated in the secretomes of MSCs from the ALL patients before treatment compared

to donors’ MSCs. b)Signaling pathways components of which were downregulated in the secretomes of MSCs from the ALL pa-

tients before treatment compared to donors’ MSCs. c)Signaling pathways components of which were upregulated in the secre-

tomes of MSCs from the ALL patients before the treatment compared to remission. d)Signaling pathways components of which

were downregulated in the secretomes of MSCs from the ALL patients before the treatment compared to remission.

LYMPHOID NEOPLASIA 895

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Fig. 6. Enrichment analysis of the signaling pathways with GO database. The most important signaling pathways components

of which were differentially found in the secretomes of MSCs from the patients with DLBCL and donors are presented. Only sig-

nificant changes (p<0.05) were taken into account. Histograms represent -log10 FDR (false discovery rate) values. a)Signaling

pathways components of which were upregulated in the secretomes of MSCs from the DLBCL patients before treatment com-

pared to donors’ MSCs. b)Signaling pathways components of which were downregulated in the secretomes of MSCs from the

DLBCL patients before treatment compared to donors’ MSCs. c)Signaling pathways components of which were upregulated in

the secretomes of MSCs from the DLBCL patients before treatment compared to remission. d)Signaling pathways components

of which were downregulated in the secretomes of MSCs from the DLBCL patients before treatment compared to remission.

PETINATI et al.896

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

The obtained data indicate significant impairment

of the MSCs’ functional properties in ALL, both before

treatment and in remission.

At the onset of DLBCL, secretion of 77 proteins

was increased compared to the donors, including B2M,

CD59, HLA-C, PDGFRA, CSF1, SOD1, CAPG, and levels

of 44 proteins were reduced, including APOs, ACAN,

S100A9, LTBP4. Proteins with the increased secretion

are involved in cytokine signaling pathways, including

TNF, interferons, and interleukins, and are involved in

innate and adaptive immunity (Fig. 6a). Downregulat-

ed proteins are also involved in some of these path-

ways (Fig. 6b). Secretion of the proteins related to the

MSC differentiation and complement system was re-

duced.

Upon achieving remission, secretion of 15 pro-

teins by the patients’ MSCs increased compared to do-

nors’ MSCs. With the exception of B2M, these proteins

differ from those upregulated at the onset of DLBCL.

Important signaling pathways altered upon achieve-

ment of remission include vesicular transport, im-

mune response, and differentiation (Fig. 6c). Notewor-

thy is secretion of the proteins associated with antigen

presentation by the major histocompatibility complex

(MHC) classII. Under the standard cultural conditions,

non-activated MSCs express extremely low levels of

MHC class II, whereas the MSCs from the DLBCL pa-

tients express it much more actively.

At the same time, secretion of 73 proteins de-

creased, including APOs, ACAN, S100A9, LTBP4, PDGFA,

CFHR1, C4BPA, and CRP. Secretion of APOs, ACAN,

S100A9, LTBP4 remains reduced in the remission. Se-

cretion of the proteins that are important for immune

response, such as PDGFA and various complement

components(CFHR1, C4BPA, and CRP) was decreased.

Many of the downregulated proteins are involved in

the immune system – complement system, activation

of platelets and neutrophils (Fig.6d).

The changes observed in the secretomes of the

MSCs from the patients with ALL and DLBCL indicate

systemic inflammation affecting bone marrow in both

nosologies. In remission, secretion of the inflamma-

tion-related proteins decreases, but the secretome

does not normalize.

None of the proteins with the altered secretion

compared to the donors at the onset and remission

of the disease matched between ALL and DLBCL. The

same is true for the proteins that differ between the

onset and the remission in ALL and DLBCL.

DISCUSSION

Inflammation involves not only the cells directly

related to the immune system, but also many others,

including MSCs. It has been shown invitro that MSCs

are able to modulate immune response both through

direct intercellular interaction and through secretion

of various factors. In addition, MSCs, being precursors

of the bone marrow stromal microenvironment, reg-

ulate hematopoiesis and, as a result, formation of all

cells of the immune system. Lymphoid tumors upset

the balance of the immune system, not only by impair-

ing lymphopoiesis, but also by altering other cells as-

sociated with the immune system.

Lymphoproliferative diseases considered in this

work– DLBCL and ALL– differ in cell differentiation

stage and localization. In ALL, early lymphoid progen-

itors are located in the bone marrow, while in DLBCL,

a tumor of more mature B cells may not affect the

bone marrow, as happened in patients whose MSCs

were studied in this work. However, it is known that

the properties of MSCs change significantly not only in

ALL [28], when they are in close proximity to malig-

nant cells and interact with them, but also in DLBCL,

in the absence of direct contact [5].

In the case when the same number of bone mar-

row mononuclear cells is seeded, the time it takes to

achieve confluency depends on the number of plas-

tic-attaching cells capable of proliferating, and thus

may indirectly reflect the number of mesenchymal

precursors in the bone marrow. The increase in time

to P0 only in the MSCs of the patients at the onset of

ALL is most likely due to the fact that only in this case

the MSCs are in direct contact with tumor cells and are

damaged by them. This assumption correlates with

the results of other studies indicating damage to the

stromal microenvironment in acute leukemia [29-31].

In DLBCL, on the contrary, activation of the stromal

microenvironment can be assumed, since increase in

the cell production of these patients’ MSCs was ob-

served both at the onset of the disease and in the re-

mission. Moreover, in remission, the time to P0 was

also reduced, i.e., concentration of the stromal precur-

sors in the bone marrow increased.

It is believed that leukemia is associated with

chronic inflammation [32, 33]. The study of surface

phenotype of the MSCs in ALL patients showed in-

creased MFI of the class I major histocompatibility

complex (HLA-ABC) and ecto-5′-nucleotidase (CD73)

proteins prior to the treatment. In addition, the MSCs

of ALL patients before treatment secreted more HLA-

DRB than the donor cells. The MSCs of patients at the

onset of DLBCL did not differ from the cells of healthy

donors in these parameters. However, upon reaching

remission, surface expression of HLA of both classes

(HLA-ABC and HLA-DR), CD73, CD54, and CD146 sig-

nificantly increased. In the secretomes of DLBCL pa-

tients’ MSCs, content of HLA-C and B2M proteins was

increased at the onset of the disease. In remission,

B2M remained upregulated. These changes suggest

that the MSCs, on which HLAs are typically weakly

LYMPHOID NEOPLASIA 897

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

expressed, are in a pro-inflammatory environment in

the bone marrow and remain activated upon trans-

fer to culture. CD73 has an immunosuppressive effect

through generation of adenosine. Increase in the sur-

face expression of this marker indicates that the MSCs

execute an anti-inflammatory effect. It is known that

increased expression of CD73 frequently occurs in the

tumor cells and cells of the tumor microenvironment

[34-36]. It seems this immune escape mechanism is

implemented by MSCs in ALL and DLBCL. CD54, or

ICAM-1, is an adhesion molecule that is upregulat-

ed when the cells are activated [37, 38]. CD146 is an

adhesion molecule considered to be a marker of the

MSCs with high proliferative potential and ability to

differentiate [39]. Based on this, one could expect fast-

er growth or greater cell production by the MSCs with

increased CD146 expression, which was observed in

the cells of DLBCL patients after treatment. We studied

the MSCs in the DLBCL patients without bone marrow

involvement. In the MSCs of DLBCL patients, prolifera-

tive activation was not observed before treatment, but

occurred in remission, which implies that activation

might be associated with the treatment. Chemotherapy

activates and severely damages immune system of the

patients [40].

In remission of DLBCL, an increased content of

CD105, or endoglin, was also found on the MSCs. En-

doglin is involved in keeping hematopoietic stem cells

in a dormant state along with TGFβ1 [41]. Expression

level of the TGFB1 gene in the MSCs was reduced at

the onset of ALL, which could contribute to tumor

proliferation. After chemotherapy, TGFB1 REL was re-

duced in both ALL and DLBCL. Perhaps this is neces-

sary to restore hematopoiesis and immunity, which are

inevitably damaged during treatment.

Among the factors influencing the immune re-

sponse, an increase in the REL of the pro-inflammato-

ry cytokine IL6 was observed at the onset of ALL. It did

not normalize upon reaching remission. MSCs could

contribute to the increase in the IL6 level observed in

the blood of the patients [42]. We did not find a sig-

nificant increase in the IL6 level in the secretome of

the MSCs, which could be due to insufficient number

of samples and limitations of the method, since oth-

er groups observed increased secretion of IL6 by the

MSCs from ALL patients using the ELISA method [43].

In the patients with DLBCL, increased IL8 expression

was noted before the treatment and increased expres-

sion of IL6 and IL8 after the treatment. Upregulated

expression of the pro-inflammatory interleukin genes

in remission may reflect massive changes in immune

processes associated with both chemotherapy and con-

sequent infectious complications, which is consistent

with the observations of other authors [9].

SDF-1 (CXCL-12) is important for interaction with

HSC. Its expression in the MSCs of the patients did not

differ from the healthy donors in either ALL or DLBCL.

Previous studies have noted that SDF1 expression does

not change in acute myeloid leukemia (AML) [44,  45],

but the level of protein on the surface of the MSCs in

patients is increased [46]. It has been shown that in

ALL, on the contrary, concentration of SDF-1 in the

bone marrow decreases [43,  47]. In the patients’ MSCs

studied in this work, there was a trend towards in-

creased expression of this factor. In the secretomes of

those cells, SDF-1 was significantly upregulated. It can

be assumed that regulation of SDF-1 in acute leukemia

does not occur at the transcription level.

In both ALL and DLBCL, expression of cytokines

involved in formation and regeneration of the stroma

was altered. At the onset of ALL expression of VEGFA

in the MSCs was downregulated despite the fact that

VEGF-A concentration in the blood of the patients is

increased [48,49]. It is possible that the MSCs reduce

expression of this growth factor due to a feedback

loop, and malignant cells are responsible for its secre-

tion [48]. In DLBCL patients’ MSCs, expression of many

growth factors and their receptors was impaired. It is

possible that these changes would have contributed to

the spread of the tumor to bone marrow if the patients

had remained without treatment.

In ALL, change in the relative levels of expression

of the gene markers of MSC predisposition to differen-

tiation lineages was observed. Increased expression

of PPARG suggests that the MSCs of ALL patients are

more prone to adipogenic differentiation than the

MSCs of the healthy donors. This is also confirmed by

a decrease in expression of SOX9, a chondrogenic dif-

ferentiation marker, which, according to some studies,

is able to inhibit differentiation of MSCs into adipo-

cytes [50]. According to the literature data, the MSCs

from ALL patients show an increased tendency to adi-

pose differentiation [28,  43]. Decrease in SOX9 expres-

sion has also been noted [43]. It is worth emphasizing

that the changes in expression of these genes persisted

even after the patients achieved remission. Perhaps

more serious changes occurring in ALL are caused by

the contact with malignant cells.

In DLBCL, no changes in the RELs of the differen-

tiation markers were noted in the MSCs.

The signaling pathways enrichment analysis

showed an indirect relationship between the changes

in the expression of IL8, IL6, TGFB1, VEGFA, PDGFRB,

PPARG and the secretome.

The secretome analysis revealed decrease in the

secretion of proteins involved in regulation of the

immune response and vesicular transport both be-

fore and after the ALL treatment compared to the

donors. Secretion of the vesicles is important for the

regulatory and trophic functions of MSCs [51]. Dys-

regulation of the vesicular transport indicates the

MSCs damage. The MSCs also interact differently

PETINATI et al.898

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

with the extracellular matrix, which is involved in

the regulation of hematopoietic stem cells and B-lym-

phopoiesis [52].

The proteins downregulated in ALL before treat-

ment include: ADAMTS1 – an angiogenesis-inhibiting

metalloprotease associated with VCAM1 (whose se-

cretion is also reduced) [53]; CTGF, connective tissue

growth factor, that plays an important role in some

forms of cancer, fibrotic diseases, and in many biolog-

ical processes, including cell adhesion, migration, pro-

liferation, and angiogenesis [54]; CSF1, a macrophage

growth factor, stimulates increase in phagocytic and

chemotactic activity of macrophages and monocytes,

as well as cytotoxicity against tumor cells [55].

Factors with increased secretion in the MSCs of

ALL patients before treatment compared to the donors

regulate cell migration and are associated with actin

cytoskeleton rearrangement. Those can attract both

immune cells and circulating tumor cells to the bone

marrow.

Presence of a tumor in the body is usually associ-

ated with chronic inflammation [21,  22]. Our observa-

tions are consistent with this hypothesis. Upon achiev-

ing remission of ALL, the MSCs reduced secretion of

the factors involved in the response to proinflamma-

tory cytokines, such as IL-1, TNF, and others (Fig. 5b).

Secretion of some of these factors was decreased be-

fore the treatment and increased when remission was

achieved (Fig. 5d). Several signaling pathways have

components that were differentially secreted: a part of

them was upregulated and a part was downregulated

in the same groups, suggesting that some of the chang-

es may be compensatory.

The list of proteins with secretion reduced in

ALL remission includes C3 complement component;

insulin-like growth factor binding proteins –  IGFBP1,

IGFBP3, which regulate cell growth, and IGFBP6, which

regulates growth and immune response of dendritic

cells [56]; LGALS1 or galectin-1, a protein that inhibits

cell proliferation and is involved in immunosuppres-

sion of CD8

T cells [57]; ENO1, a glycolytic enzyme that

functions as a tumor suppressor and is important for

chemoresistance in lymphomas [58]; ANXA1, annex-

inA1, that inhibits innate immune cells and promotes

T cell activation. Activation of T  cells results in the

release of annexin A1 and expression of its receptor.

This pathway appears to finely regulate the strength

of T cell receptor (TCR) signaling. Increased expression

of annexin A1 under pathological conditions could

enhance TCR signaling through the mitogen-activat-

ed protein kinase (MAPK) signaling pathway, thereby

causing T  cell hyperactivation [59]. With the decrease

in secretion of these proteins, the tumor more easily

escapes immune surveillance, partially provided by

the MSCs. It can be concluded that the MSCs of ALL pa-

tients undergo a complex of changes that contribute to

imbalance of immune system and escape of the tumor

cells from immune surveillance.

The MSCs of the DLBCL patients included in the

study were immunologically activated, despite the fact

that the bone marrow was not directly involved in the

tumor process. This is indicated by the increased se-

cretion of the proteins from the signaling pathways

that mediate the immune response, including the pre-

sentation of antigens by the MHCs and the response to

proinflammatory cytokines. After treatment, secretion

of the proteins related to inflammatory processes de-

creased.

In the secretome of MSCs of the patients both be-

fore and after DLBCL treatment, secretion of ACAN,

S100A9, LTBP4, and a number of APOs (apolipopro-

teins) was downregulated compared to donors. When

remission was achieved, secretion of PDGFA, CFHR1,

C4BPA, and CRP decreased as well.

ACAN, or aggrecan, is critical for cartilage skeletal

morphogenesis during development and is expressed

by chondrocytes [60]. Lack of expression of this pro-

tein could be associated with impaired cartilage and

bone differentiation in the patients with DLBCL. In

addition, aggrecan could be involved in the antigen

presentation, as shown for the chondrocytes during in-

flammation [61].

The S100A9 protein is calcium-binding protein A9,

also known as migration inhibitory factor-related pro-

tein14 (MRP14). Intracellular S100A9 is known to re-

duce the ability of neutrophils to respond to bacterial

pathogens [62].

Decrease in the LTBP4 protein, a key regulator of

transforming growth factor beta (TGFB1, TGFB2, and

TGFB3), which controls activation of TGF-β maintain-

ing it in a latent state during storage in the extracel-

lular space, is associated with the functions of TGF-β.

TGF-β is biologically latent after secretion. Thus, LTBP4

is an important regulator of TGF-β signaling and is in-

directly associated with the development, immunity,

injury recovery, and disease, playing a central role in

regulation of inflammation, fibrosis, and cancer pro-

gression [63]. CFHR1, C4BPA, CRP are elements of the

complement system that are normally secreted by the

cells, including MSCs and pericytes, to protect the body

from infections [64].

Decrease in all these proteins in the secretome

of MSCs confirms deterioration of their physiological

functions associated with hematopoiesis and immuni-

ty in the DLBCL patients.

Increased secretion of B2M, CD59, HLA-C, PDGFRA,

CSF1, SOD1, CAPG at the onset of DLBCL in the MSC se-

cretome indicates MSC activation in the bone marrow

of the DLBCL patients without tumor involvement.

Inthe remission, the level of these proteins, with the

exception of B2M, normalized, which implies that

these changes are partially reversible.

LYMPHOID NEOPLASIA 899

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Comparison of MSC secretomes of patients with

ALL and DLBCL confirmed the presence of significant

functional changes in comparison with the donors and

the difference of the nosologies from each other. The

MSCs from the DLBCL patients did not secrete many

proteins secreted by the MSCs from the donors and

the patients with ALL; proteins involved in regulation

of the immune response, PDGFA, POSTN, and LGALS1

(reduced in the secretomes of MSCs in ALL) and KIT

were not found in their secretomes. POSTN is a secret-

ed extracellular matrix protein that is involved in tis-

sue development and regeneration, binds to integrins

to support adhesion and migration, and plays a role

in cancer stem cell maintenance and metastasis [65].

Growth factors that support stromal cells and hema-

topoietic stem cells are also absent in the secretomes

of MSCs from the DLBCL patients, which confirms ab-

normalities in the bone marrow MSCs without direct

contact with the tumor B cells.

Thus, regardless of the tumor location, there are

significant changes in the functional status of bone

marrow MSCs, which contribute to the decrease in

antitumor immunity in the lymphoid neoplasia. In ad-

dition, in both pathologies, the MSCs acquire features

of the senescent cells associated with chronic inflam-

mation. The MSC senescence may be the reason for in-

complete restoration of hematopoiesis for a long peri-

od after achieving remission.

Analysis of the functional status of MSCs revealed

both differences and similarities between the impair-

ments occurring in the MSCs during the transforma-

tion of early hematopoietic precursors in the bone

marrow (ALL) and more mature ones outside the bone

marrow (DLBCL). Some of the differences may be re-

lated to the participation of the bone marrow lym-

phocytes in the MSC differentiation  [66]. In ALL, pre-

disposition of the MSCs to bone and fat differentiation

changes as evidenced by the gene expression and pro-

tein secretion. Some of the differences between the

DLBCL and ALL are age related. In DLBCL, signaling

pathways of the growth factors IGF and PDGF in the

MSCs are altered.

Identification of the specific signs in the bone mar-

row stroma indicates the possibility of the relapse risk

assessment [46]. A more detailed study of the metabo-

lism of MSCs from the patients will allow for identifica-

tion of the drugs that could modulate reactive oxygen

species associated with inflammation and cell aging.

CONCLUSION

Lymphoid neoplasias have a pathological effect on

the function of bone marrow MSCs. Concentration of

these cells in the bone marrow, their ability to prolif-

erate, immunophenotype, and expression pattern of

the genes important for differentiation, maintenance

of immunological status, and expression of cytokines

change. The functions of MSCs are diverse and form a

complex of reactions to the state and demands of the

body. Changes in the immunological status of MSCs de-

pend on the nosology and, despite the fundamental dif-

ferences, generally contribute to optimizing the niche

for the needs of the tumor and tumor escape from im-

munological surveillance. The obtained data demon-

strate the importance of MSCs for immunity and imply

the possibility to target not only the malignant cells,

but their microenvironment as well. Lymphoid tumors

are not only the transformation of hematopoietic cells

of varying degrees of maturity, but also concomitant

changes in the stromal microenvironment.

Acknowledgments. The equipment (tablet reader

Infinite 200 (Tecan, Austria)) from the collective use

center of the Pushchino Scientific Center was used in

the work. The authors also express their gratitude to

the Center for High-Precision Editing and Genetic Tech-

nologies for Biomedicine of the Lopukhin Center for

Physical-Chemical Medicine for LC-MS/MS analysis.

Contributions. E.N.P. supervised and managed

the work with the patients; N.A.P. and N.I.D. concep-

tualized and managed the study; E.A.F., A.U.M., A.N.V.,

and O.A.A. worked with the donors and patients;

N.A.P., A.V.S., N.V.S., N.M.K., and Yu.O.D. conducted the

experiments with MSCs; M.A.L. supervised the secre-

tome analysis and edited the text of the article; G.P.A.,

V.O.Sh., I.P.S., and O.V.P. performed the secretome study

and bioinformatic analysis; N.A.P., A.V.S., and N.I.D. an-

alyzed the study results; N.A.P., A.V.S. and N.I.D. wrote

and edited the text of the article.

Funding. This work was supported by the Rus-

sian Foundation for Basic Research (grant no.17-001-

00170) (DLBCL patients and donors’ samples) and by

the Russian Science Foundation (grant no.22-15-00018,

https://rscf.ru/project/22-15-00018/ [in Russian]) (all pa-

tients and donors’ samples).

Ethics declarations. All procedures performed

in the course of research comply with the ethical

standards of the national committee (permission to

conduct the study was obtained from the ethical com-

mittee for research ethics (National Medical Research

Center for Hematology of the Ministry of Health of the

Russian Federation, protocol no. 171 of 04/27/2023)).

All studies were conducted in accordance with the

principles of biomedical ethics as outlined in the 1964

Declaration of Helsinki and its later amendments.

Each participant in the study provided a volun-

tary written informed consent after receiving an ex-

planation of the potential risks and benefits, as well as

the nature of the upcoming study.

The authors of this work declare that they have

no conflicts of interest.

PETINATI et al.900

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

REFERENCES

1. Schürch, C.M., Caraccio,C., and Nolte, M.A. (2021) Di-

versity, localization, and (patho)physiology of mature

lymphocyte populations in the bone marrow, Blood,

137, 3015-3026, doi:10.1182/blood.2020007592.

2. Kaushansky,K., and Zhan,H. (2018) The regulation of

normal and neoplastic hematopoiesis is dependent on

microenvironmental cells, Adv. Biol. Regul., 69, 11-15,

doi:10.1016/J.JBIOR.2018.06.003.

3. Beerman,I., Luis, T.C., Singbrant,S., Lo Celso,C., and

Méndez-Ferrer,S. (2017) The evolving view of the he-

matopoietic stem cell niche, Exp. Hematol., 50, 22-26,

doi:10.1016/j.exphem.2017.01.008.

4. Luca, D.C. (2021) Update on lymphoblastic leukemia/

lymphoma, Clin. Lab. Med., 41, 405-416, doi:10.1016/

J.CLL.2021.04.003.

5. Petinati, N. A., Bigildeev, A. E., Karpenko, D. S., Sats,

N.V., Kapranov, N.M., Davydova, Y.O., Fastova, E.A.,

Magomedova, A.U., Kravchenko, S.K., Arapidi, G.P.,

Rusanova, M. I., Lagarkova, M. M., Drize, N. I., and

Savchenko, V.G. (2021) Humoral effect of a B-cell tu-

mor on the bone marrow multipotent mesenchymal

stromal cells, Biochemistry (Moscow), 86, 207-216,

doi:10.1134/S0006297921020097.

6. Zhou, X., Ramachandran, S., Mann, M., and Popkin,

D.L. (2012) Role of lymphocytic choriomeningitis vi-

rus (LCMV) in understanding viral immunology: past,

present and future, Viruses, 4, 2650-2669, doi:10.3390/

v4112650.

7. Schürch, C.M., Riether,C., and Ochsenbein, A.F. (2014)

Cytotoxic CD8

T cells stimulate hematopoietic pro-

genitors by promoting cytokine release from bone

marrow mesenchymal stromal cells, Cell Stem Cell,

14, 460-472, doi:10.1016/j.stem.2014.01.002.

8. Demerdash,Y., Kain,B., Essers, M.A.G., and King, K.Y.

(2021) Yin and Yang: the dual effects of interferons on

hematopoiesism, Exp. Hematol., 96, 1-12, doi:10.1016/

j.exphem.2021.02.002.

9. Isringhausen, S., Mun, Y., Kovtonyuk, L., Kräutler,

N. J., Suessbier, U., Gomariz, A., Spaltro,G., Helbling,

P.M., Chyn Wong,H., Nagasawa,T., Manz, M.G., Oxe-

nius,A., and Nombela-Arrieta,C. (2021) Chronic viral

infections persistently alter marrow stroma and im-

pair hematopoietic stem cell fitness, J.Exp. Med., 218,

e20192070, doi:10.1084/jem.20192070.

10. Fallati, A., Di Marzo, N., D’amico, G., and Dander, E.

(2022) Mesenchymal stromal cells (MSCs): an ally of

B-cell acute lymphoblastic leukemia (B-ALL) cells

in disease maintenance and progression within the

bone marrow hematopoietic niche, Cancers, 14, 3303,

doi:10.3390/CANCERS14143303.

11. Kihira,K., Chelakkot, V.S., Kainuma,H., Okumura,Y.,

Tsuboya, N., Okamura, S., Kurihara, K., Iwamoto, S.,

Komada,Y., and Hori,H. (2020) Close interaction with

bone marrow mesenchymal stromal cells induces the

development of cancer stem cell-like immunopheno-

type in B cell precursor acute lymphoblastic leukemia

cells, Int.J. Hematol., 112, 795-806, doi:10.1007/s12185-

020-02981-z.

12. Chiarini, F., Lonetti, A., Evangelisti, C., Buontem-

po, F., Orsini, E., Evangelisti, C., Cappellini, A., Neri,

L.M., McCubrey, J.A., and Martelli, A.M. (2016) Ad-

vances in understanding the acute lymphoblastic

leukemia bone marrow microenvironment: from

biology to therapeutic targeting, Biochim. Bio-

phys. Acta, 1863, 449-463, doi: 10.1016/j.bbamcr.

2015.08.015.

13. Zhi-Gang, Z., Wei-Ming, L., Zhi-Chao, C., Yong, Y.,

and Ping, Z. (2008) Immunosuppressive prop-

erties of mesenchymal stem cells derived from

bone marrow of patient with hematological ma-

lignant diseases, Leuk. Lymphoma, 49, 2187-2195,

doi:10.1080/10428190802455875.

14. Beltran, B. E., Quiñones, P., Morales, D., Malaga,

J.M., Chavez, J.C., Sotomayor, E.M., and Castillo, J.J.

(2018) Response and survival benefit with chemoim-

munotherapy in Epstein-Barr virus-positive diffuse

large B-cell lymphoma, Hematol. Oncol., 36, 93-97,

doi:10.1002/hon.2449.

15. Swerdlow, S. H. (2017) in WHO Classification of Tu-

mours (Swerdlow, S.H., Campo, E., Harris, N.L., Jaffe,

E. S., Pileri, S. A., Stein, H., and Thiele, J., eds) Lyon,

International Agency for Research on Cancer, Lyon,

pp.199-215.

16. Fastova, E.A., Magomedova, A.U., Petinati, N.A., Sats,

N. V., Kapranov, N. M., Davydova, Y. O., Drize, N. I.,

Kravchenko, S. K., and Savchenko, V. G. (2019) Bone

marrow multipotent mesenchymal stromal cells in

patients with diffuse large B-Cell lymphoma, Bull.

Exp. Biol. Med., 167, 150-153, doi: 10.1007/s10517-

019-04480-6.

17. Chen, Q., Yuan, Y., and Chen, T. (2014) Morphology,

differentiation and adhesion molecule expression

changes of bone marrow mesenchymal stem cells

from acute myeloid leukemia patients, Mol. Med. Rep.,

9, 293-298, doi:10.3892/mmr.2013.1789.

18. Shipounova, I.N., Petrova, T.V., Svinareva, D.A., Mo-

motuk, K.S., Mikhailova, E.A., and Drize, N.I. (2009)

Alterations in hematopoietic microenvironment in pa-

tients with aplastic anemia, Clin. Transl. Sci., 2, 67-74,

doi:10.1111/j.1752-8062.2008.00074.x.

19. Kotyza,J. (2017) Chemokines in tumor proximal fluids,

Biomed. Pap. Med. Fac. Univ. Palacky Olomouc. Czech.

Repub., 161, 41-49, doi:10.5507/bp.2016.062.

20. Vilgelm, A. E., and Richmond, A. (2019) Chemokines

modulate immune surveillance in tumorigenesis,

metastasis, and response to immunotherapy, Front.

Immunol., 10, 333, doi:10.3389/fimmu.2019.00333.

21. Mantovani, A., Allavena, P., Sica, A., and Balkwill, F.

(2008) Cancer-related inflammation, Nature, 454,

436-444, doi:10.1038/nature07205.

LYMPHOID NEOPLASIA 901

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

22. Okrój,M., and Potempa,J. (2019) Complement activa-

tion as a helping hand for inflammophilic pathogens

and cancer, Front. Immunol., 9, 3125, doi: 10.3389/

fimmu.2018.03125.

23. Lund, F. E. (2008) Cytokine-producing B lympho-

cytes-key regulators of immunity, Curr. Opin. Immu-

nol., 20, 332-338, doi:10.1016/j.coi.2008.03.003.

24. Munir, H., Ward, L. S. C., and McGettrick, H. M.

(2018) Mesenchymal stem cells as endogenous reg-

ulators of inflammation, Adv. Exp. Med. Biol., 1060,

73-98, doi:10.1007/978-3-319-78127-3_5.

25. Schmittgen, T.D., and Livak, K.J. (2008) Analyzing re-

al-time PCR data by the comparative CT method, Nat.

Protocols, 3, 1101-1108, doi:10.1038/nprot.2008.73.

26. Kumar, L. P., Kandoi, S., Misra, R., and Verma, R. S.

(2019) The mesenchymal stem cell secretome: a new

paradigm towards cell-free therapeutic mode in re-

generative medicine, Cytokine Growth Factor Rev.,

46, 1-9, doi:10.1016/j.cytogfr.2019.04.002.

27. Dominici, M., Le Blanc, K., Mueller, I., Slaper-Corten-

bach, I., Marini, F., Krause,D., Deans,R., Keating,A.,

Prockop, D., and Horwitz, E. (2006) Minimal crite-

ria for defining multipotent mesenchymal stromal

cells. The international society for cellular ther-

apy position statement, Cytotherapy, 8, 315-317,

doi:10.1080/14653240600855905.

28. Vanegas, N.-D. P., Ruiz-Aparicio, P. F., Uribe, G. I., Li-

nares-Ballesteros, A., and Vernot, J.-P. (2021) Leu-

kemia-Induced cellular senescence and stemness

alterations in mesenchymal stem cells are revers-

ible upon withdrawal of B-cell acute lymphoblastic

leukemia cells, Int.J. Mol. Sci., 22, 8166, doi:10.3390/

ijms22158166.

29. Schroeder, T., Geyh, S., Germing, U., and Haas, R.

(2016) Mesenchymal stromal cells in myeloid malig-

nancies, Blood Res., 51, 225-232, doi:10.5045/br.2016.

51.4.225.

30. Passaro, D., Di Tullio, A., Abarrategi, A., Rouault-

Pierre, K., Foster, K., Ariza-McNaughton, L., Montan-

er,B., Chakravarty,P., Bhaw,L., Diana,G., Lassailly,F.,

Gribben,J., and Bonnet,D. (2017) Increased vascular

permeability in the bone marrow microenvironment

contributes to disease progression and drug response

in acute myeloid leukemia, Cancer Cell, 32, 324-341.

e6, doi:10.1016/J.CCELL.2017.08.001.

31. Shipounova, I. N., Petinati, N. A., Bigildeev, A. E.,

Drize, N.J., Sorokina, T.V., Kuzmina, L.A., Parovich-

nikova, E.N., and Savchenko, V.G. (2017) Alterations

of the bone marrow stromal microenvironment

in adult patients with acute myeloid and lympho-

blastic leukemias before and after allogeneic he-

matopoietic stem cell transplantation, Leuk. Lym-

phoma, 58, 408-417, doi: 10.1080/10428194.2016.

1187277.

32. Ludin, A., Gur-Cohen, S., Golan, K., Kaufmann, K. B.,

Itkin,T., Medaglia,C., Lu, X.-J., Ledergor,G., Kollet,O.,

and Lapidot, T. (2014) Reactive oxygen species regu-

late hematopoietic stem cell self-renewal, migration

and development, as well as their bone marrow mi-

croenvironment, Antioxid. Redox Signal., 21, 1605-

1619, doi:10.1089/ars.2014.5941.

33. Récher,C. (2021) Clinical implications of inflammation

in acute myeloid leukemia, Front. Oncol., 11, 623952,

doi:10.3389/fonc.2021.623952.

34. Beavis, P. A., Stagg, J., Darcy, P. K., and Smyth, M. J.

(2012) CD73: a potent suppressor of antitumor im-

mune responses, Trends Immunol., 33, 231-237,

doi:10.1016/j.it.2012.02.009.

35. Jin,D., Fan,J., Wang,L., Thompson, L.F., Liu,A., Dan-

iel, B.J., Shin,T., Curiel, T.J., and Zhang,B. (2010) CD73

on tumor cells impairs antitumor T-cell responses:

a novel mechanism of tumor-induced immune sup-

pression, Cancer Res., 70, 2245-2255, doi: 10.1158/

0008-5472.CAN-09-3109.

36. Petruk, N., Tuominen, S., Åkerfelt, M., Mattsson, J.,

Sandholm, J., Nees, M., Yegutkin, G. G., Jukkola, A.,

Tuomela, J., and Selander, K. S. (2021) CD73 Facili-

tates EMT Progression and Promotes Lung Metastases

in Triple-Negative Breast Cancer, Sci. Rep., 11, 6035,

doi:10.1038/S41598-021-85379-Z.

37. Bui, T. M., Wiesolek, H. L., and Sumagin, R. (2020)

ICAM-1: a master regulator of cellular respons-

es in inflammation, injury resolution, and tumori-

genesis, J. Leukoc. Biol., 108, 787-799, doi: 10.1002/

JLB.2MR0220-549R.

38. Ren, G., Zhao, X., Zhang, L., Zhang, J., L’Huillier, A.,

Ling,W., Roberts, A.I., Le, A.D., Shi,S., Shao,C., and

Shi, Y. (2010) Inflammatory cytokine-induced inter-

cellular adhesion molecule-1 and vascular cell adhe-

sion molecule-1 in mesenchymal stem cells are critical

for immunosuppression, J.Immunol., 184, 2321-2328,

doi:10.4049/jimmunol.0902023.

39. Russell, K.C., Phinney, D.G., Lacey, M.R., Barrilleaux,

B. L., Meyertholen, K. E., and O’Connor, K. C. (2010)

In vitro high-capacity assay to quantify the clonal

heterogeneity in trilineage potential of mesenchy-

mal stem cells reveals a complex hierarchy of lineage

commitment, Stem Cells, 28, 788-798, doi: 10.1002/

stem.312.

40. Schirrmacher,V. (2019) From chemotherapy to biolog-

ical therapy: a review of novel concepts to reduce the

side effects of systemic cancer treatment, Int.J. Oncol.,

54, 407-419, doi:10.3892/ijo.2018.4661.

41. Borges,L., Oliveira, V.K.P., Baik,J., Bendall, S.C., and

Perlingeiro, R. C. R. (2019) Serial transplantation re-

veals a critical role for endoglin in hematopoietic

stem cell quiescence, Blood, 133, 688-696, doi:10.1182/

blood-2018-09-874677.

42. Portale,F., Cricrì,G., Bresolin,S., Lupi,M., Gaspari,S.,

Silvestri,D., Russo,B., Marino,N., Ubezio,P., Pagni,F.,

Vergani, P., Te Kronnie, G., Valsecchi, M. G., Locatel-

li,F., Rizzari,C., Biondi,A., Dander,E., and D’Amico,G.

PETINATI et al.902

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

(2019) ActivinA: a new leukemia-promoting fac-

tor conferring migratory advantage to B-cell pre-

cursor-acute lymphoblastic leukemic cells, Hae-

matologica, 104, 533-545, doi: 10.3324/haematol.

2018.188664.

43. Balandrán, J.C., Purizaca,J., Enciso,J., Dozal,D., San-

doval,A., Jiménez-Hernández,E., Alemán-Lazarini,L.,

Perez-Koldenkova, V., Quintela-Núñez del Prado, H.,

Rios de los Ríos, J., Mayani, H., Ortiz-Navarrete, V.,

Guzman, M. L., and Pelayo, R. (2017) Pro-inflamma-

tory-related loss of CXCL12 niche promotes acute

lymphoblastic leukemic progression at the expense

of normal lymphopoiesis, Front. Immunol., 7, 666,

doi:10.3389/fimmu.2016.00666.

44. Desbourdes, L., Javary, J., Charbonnier, T., Ishac, N.,

Bourgeais, J., Iltis, A., Chomel, J.-C., Turhan, A., Guil-

loton, F., Tarte, K., Demattei, M.-V., Ducrocq, E., Rou-

leux-Bonnin, F., Gyan, E., Hérault, O., and Dome-

nech, J. (2017) Alteration analysis of bone marrow

mesenchymal stromal cells from de novo acute my-

eloid leukemia patients at diagnosis, Stem. Cells Dev.,

26, 709-722, doi:10.1089/scd.2016.0295.

45. Chandran, P., Le, Y., Li, Y., Sabloff, M., Mehic, J., Ro-

su-Myles, M., and Allan, D. S. (2015) Mesenchymal

stromal cells from patients with acute myeloid leu-

kemia have altered capacity to expand differentiated

hematopoietic progenitors, Leuk. Res., 39, 486-493,

doi:10.1016/j.leukres.2015.01.013.

46. Kim, J.-A., Shim, J.-S., Lee, G.-Y., Yim, H. W., Kim, T.-

M., Kim, M., Leem, S.-H., Lee, J.-W., Min, C.-K., and

Oh, I.-H. (2015) Microenvironmental remodeling as

a parameter and prognostic factor of heterogeneous

leukemogenesis in acute myelogenous leukemia,

Cancer Res., 75, 2222-2231, doi: 10.1158/0008-5472.

CAN-14-3379.

47. Van den Berk, L.C.J., van der Veer,A., Willemse, M.E.,

Theeuwes, M.J. G. A., Luijendijk, M. W., Tong, W.H.,

van der Sluis, I. M., Pieters, R., and den Boer, M. L.

(2013) Disturbed CXCR4/CXCL12 axis in pediatric pre-

cursor B-cell acute lymphoblastic leukemia, Blood,

122, 2643, doi:10.1182/blood.V122.21.2643.2643.

48. El-Obeid,A., Sunnuqrut,N., Hussain,A., Al-Hussein,K.,

Gutiérrez, M.I., and Bhatia,K. (2004) Immature B cell

malignancies synthesize VEGF, VEGFR-1 (Flt-1) and

VEGFR-2 (KDR), Leuk. Res., 28, 133-137, doi: 10.1016/

S0145-2126(03)00188-7.

49. Mizia-Malarz,A., and Sobol-Milejska,G. (2017) Assess-

ment of angiogenesis in children with acute lympho-

blastic leukemia based on serum vascular endotheli-

al growth factor assay, Indian J. Med. Paediatr. Oncol.,

38, 321-325, doi:10.4103/IJMPO.IJMPO_109_17.

50. Azadniv, M., Myers, J. R., McMurray, H. R., Guo, N.,

Rock, P., Coppage, M. L., Ashton, J., Becker, M. W.,

Calvi, L. M., and Liesveld, J. L. (2020) Bone marrow

mesenchymal stromal cells from acute myelogenous

leukemia patients demonstrate adipogenic differenti-

ation propensity with Implications for leukemia cell

support, Leukemia, 34, 391-403, doi: 10.1038/s41375-

019-0568-8.

51. Ren, K. (2019) Exosomes in perspective: a poten-

tial surrogate for stem cell therapy, Odontology, 107,

271-284, doi:10.1007/s10266-018-0395-9.

52. Morales-Hernández, A., and McKinney-Freeman, S.

(2021) GABA gets blood on its hands, Blood, 137, 723-

724, doi:10.1182/blood.2020008772.

53. Luque, A., Carpizo, D. R., and Iruela-Arispe, M. L.

(2003) ADAMTS1/METH1 inhibits endothelial cell

proliferation by direct binding and sequestration of

VEGF165, J.Biol. Chem., 278, 23656-23665, doi:10.1074/

JBC.M212964200.

54. Hall-Glenn,F., and Lyons, K.M. (2011) Roles for CCN2

in normal physiological processes,

Cell. Mol. Life Sci.,

68, 3209-3217, doi:10.1007/s00018-011-0782-7.

55. Nemunaitis, J. (1993) Macrophage function activat-

ing cytokines: potential clinical application, Crit. Rev.

Oncol. Hematol., 14, 153-171, doi: 10.1016/1040-8428

(93)90022-V.

56. Liso,A., Venuto,S., Coda, A.R.D., Giallongo,C., Palum-

bo, G.A., and Tibullo,D. (2022) IGFBP-6: at the cross-

roads of immunity, tissue repair and fibrosis, Int. J.

Mol. Sci., 23, 4358, doi:10.3390/ijms23084358.

57. Gandhi, M. K., Moll, G., Smith, C., Dua, U., Lamb-

ley, E., Ramuz, O., Gill,D., Marlton,P., Seymour, J.F.,

and Khanna, R. (2007) Galectin-1 mediated suppres-

sion of Epstein-Barr virus specific T-cell immunity

in classic hodgkin lymphoma, Blood, 110, 1326-1329,

doi:10.1182/blood-2007-01-066100.

58. Zhu,X., Miao,X., Wu,Y., Li,C., Guo,Y., Liu,Y., Chen,Y.,

Lu, X., Wang, Y., and He, S. (2015) ENO1 promotes

tumor proliferation and cell adhesion mediated

drug resistance (CAM-DR) in non-Hodgkin’s lym-

phomas, Exp. Cell Res., 335, 216-223, doi: 10.1016/

J.YEXCR.2015.05.020.

59. Perretti,M., and D’Acquisto,F. (2009) Annexin A1 and

glucocorticoids as effectors of the resolution of in-

flammation, Nat. Rev. Immunol., 9, 62-70, doi:10.1038/

nri2470.

60. Kiani,C., Chen,L., Wu, Y.J., Yee, A.J., and Yang, B.B.

(2002) Structure and function of aggrecan, Cell Res.,

12, 19-32, doi:10.1038/sj.cr.7290106.

61. Sengprasert,P., Leearamwat,N., Ngarmukos,S., Yuk-

tananda,P., Tanavalee,A., and Reantragoon,R. (2022)

Upregulation of antigen presentation function and

inflammation in chondrocytes by induction of pro-

teoglycan aggrecan peptides (P16-31 and P263-280),

Clin. Exp. Rheumatol., 40, 596-607, doi: 10.55563/

clinexprheumatol/hjzqfs.

62. Monteith, A. J., Miller, J. M., Maxwell, C. N., Chazin,

W. J., and Skaar, E. P. (2021) Neutrophil extracellu-

lar traps enhance macrophage killing of bacterial

pathogens, Sci. Adv., 7, eabj2101, doi: 10.1126/sciadv.

abj2101.

LYMPHOID NEOPLASIA 903

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

63. Su, C.-T., and Urban,Z. (2021) LTBP4 in health and dis-

ease, Genes, 12, 795, doi:10.3390/genes12060795.

64. Xavier,S., Sahu, R.K., Landes, S.G., Yu,J., Taylor, R.P.,

Ayyadevara,S., Megyesi,J., Stallcup, W.B., Duffield, J.S.,

Reis, E.S., Lambris, J.D., and Portilla,D. (2017) Pericytes

and immune cells contribute to complement activation

in tubulointerstitial fibrosis, Am.J. Physiol. Renal. Physi-

ol., 312, F516-F532, doi:10.1152/ajprenal.00604.2016.

65. Morra, L., and Moch, H. (2011) Periostin Expression

and epithelial-mesenchymal transition in cancer:

areview and an update, Virchows Arch., 459, 465-475,

doi:10.1007/s00428-011-1151-5.

66. Ding, L., and Morrison, S. J. (2013) Haematopoietic

stem cells and early lymphoid progenitors occupy

distinct bone marrow niches, Nature, 495, 231-235,

doi:10.1038/nature11885.

Publisher’s Note. Pleiades Publishing remains

neutral with regard to jurisdictional claims in pub-

lished maps and institutional affiliations.