Article

ISSN 0006-2979, Biochemistry (Moscow), 2024, Vol. 89, No. 5, pp. 883-903 © Pleiades Publishing, Ltd., 2024.

883

Molecular Changes in Immunological Characteristics

of Bone Marrow Multipotent Mesenchymal Stromal Cells

in Lymphoid Neoplasia

Nataliya A. Petinati

1,a

, Aleksandra V. Sadovskaya

1,2#

, Natalia V. Sats

Nikolai M. Kapranov

, Yulia O. Davydova

, Ekaterina A. Fastova

Aminat U. Magomedova

, Anastasia N. Vasilyeva

, Olga A. Aleshina

Georgiy P. Arapidi

3,4,5

, Viktoria O. Shender

3,4

, Igor P. Smirnov

, Olga V. Pobeguts

Maria A. Lagarkova

, Nina I. Drize

, and Elena N. Parovichnikova

National Medical Research Center for Hematology, Ministry of Health of the Russian Federation,

125167 Moscow, Russia

Lomonosov Moscow State University, 119991 Moscow, Russia

Lopukhin Federal Research and Clinical Center of Physical-Chemical Medicine,

Federal Medical Biological Agency, 119435 Moscow, Russia

Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences,

117997 Moscow, Russia

Moscow Institute of Physics and Technology, 141700 Dolgoprudny, Russia

e-mail: loel@mail.ru

Received September 15, 2023

Revised November 22, 2023

Accepted November 23, 2023

Abstract— Immune system and bone marrow stromal cells play an important role in maintaining normal he-

matopoiesis. Lymphoid neoplasia disturbs not only development of immune cells, but other immune response

mechanisms as well. Multipotent mesenchymal stromal cells (MSCs) of the bone marrow are involved in immune

response regulation through both intercellular interactions and secretion of various cytokines. In hematological

malignancies, the bone marrow stromal microenvironment, including MSCs, is altered. Aim of this study was to

describe the differences of MSCs’ immunological function in the patients with acute lymphoblastic leukemia (ALL)

and diffuse large B-cell lymphoma (DLBCL). In ALL, malignant cells arise from the early precursor cells localized

in bone marrow, while in DLBCL they arise from more differentiated B-cells. In this study, only the DLBCL patients

without bone marrow involvement were included. Growth parameters, surface marker expression, genes of in-

terest expression, and secretion pattern of bone marrow MSCs from the patients with ALL and DLBCL at the onset

of the disease and in remission were studied. MSCs from the healthy donors of corresponding ages were used as

controls. It has been shown that concentration of MSCs in the bone marrow of the patients with ALL is reduced at

the onset of the disease and is restored upon reaching remission; in the patients with DLBCL this parameter does

not change. Proliferative capacity of MSCs did not change in the patients with ALL; however, the cells of the DLBCL

patients both at the onset and in remission proliferated significantly faster than those from the donors. Expression

of the membrane surface markers and expression of the genes important for differentiation, immunological status

maintenance, and cytokine secretion differed significantly in the MSCs of the patients from those of the healthy

donors and depended on nosology of the disease. Secretomes of the MSCs varied greatly; a number of proteins

associated with immune response regulation, differentiation, and maintenance of hematopoietic stem cells were

Abbreviations: ALL, acute lymphoblastic leukemia; Ct,number of cycles required to reach the probe fluorescence threshold

in PCR; DLBCL,diffuse large B-cell lymphoma; HSCs,hematopoietic stem cells; MFI,mean fluorescence intensity; MSCs,mul-

tipotent mesenchymal stromal cells; REL,relative expression level.

* To whom correspondence should be addressed.

# These authors contributed equally to this work.

PETINATI et al.884

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

depleted in the secretomes of the cells from the patients. Lymphoid neoplasia leads to dramatic changes in the

functional immunological status of MSCs.

DOI: 10.1134/S0006297924050092

Keywords: multipotent mesenchymal stromal cells, acute lymphoblastic leukemia, diffuse large B-cell lymphoma,

gene expression, protein secretion

INTRODUCTION

Bone marrow is responsible for production and

maintenance of blood cell populations, including im-

mune cells, throughout the human life. In addition, it

acts as an important lymphoid organ, housing many

types of mature lymphocytes including B cells, T cells,

natural killer T cells, and innate immune cells [1].

Inbone marrow, lymphoid cells interact with the stro-

mal microenvironment and are involved in regulation

of hematopoiesis and immune response. Hematopoi-

etic stem cells (HSCs) reside in the specialized niches

that maintain them for lifelong blood cell production.

Niches also provide homing and survival of HSCs, reg-

ulate their dormant state, self-renewal, differentiation,

and proliferation. Many cell types are involved in for-

mation and functioning of these niches [2]. Main niche

components include mesenchymal stem cells, which

differentiate into numerous other stromal cells that

make up the niche, keep HSCs in it, and take part in

immune responses in the bone marrow [3].

B-cell lymphoproliferative disorders, which in-

clude multiple myeloma, Hodgkin’s lymphoma, and

chronic lymphocytic leukemia (CLL), as well as pre-

cursor conditions such as monoclonal B-cell lympho-

cytosis, are pathologies characterized by uncontrolled

growth of B-lymphocytes [4]. Lymphoproliferative dis-

orders can occur either in the lymphatic tissues (as

in lymphoma) or in the bone marrow (as in CLL and

multiple myeloma). Course of the disease and treat-

ment vary widely depending on the type of neoplasia

and other individual factors; however, even extramed-

ullary tumors affect the bone marrow stromal micro-

environment [5]. In addition, the bone marrow stroma

can be strongly affected by chronic viral infections.

For example, the CXCL12-abundant reticular cells (CAR

cells) die in the mice with chronic lymphocytic chori-

omeningitis due to production of IFN-α and IFN-γ by

the virus-specific CD8

T cells [6]. Chronic viral infec-

tions are associated with hematopoiesis suppression,

bone marrow failure, and depletion of the HSC pool

[7,8]. Combination of functional analysis with 3D mi-

croscopy demonstrated that chronic infection with

lymphocytic choriomeningitis virus leads to the death

of most mesenchymal CAR cells and pro-inflammatory

transcriptional remodeling of the remaining ones. This

causes long-term functional defects and reduced com-

petitive repopulation ability of HSCs. Bone marrow

immunopathology is caused by the virus-specific acti-

vated CD8

T cells that accumulate in the bone mar-

row through the interferon-dependent mechanisms.

Combined inhibition of the IFN type I and type  II

pathways by antibodies completely prevents CAR cell

degeneration and protects HSCs from chronic dysfunc-

tion. Thus, viral infections and subsequent immune

response have a lasting effect on the bone marrow ho-

meostasis, permanently reducing repopulation ability

of HSCs and disrupting secretion of the key stromal cy-

tokines that support hematopoiesis [9].

Acute lymphoblastic leukemia (ALL) is a neopla-

sia arising from early progenitors of B-cells(B-ALL) or

T-cells (T-ALL). The disease is characterized by uncon-

trolled proliferation of lymphoid progenitors in the

bone marrow and consequent appearance of large

numbers of immature lymphocytes, disrupting normal

hematopoiesis. B-ALL is considered a genetic disease,

but increasing evidence points to the ability of the

bone marrow microenvironment to significantly con-

tribute to maintenance, progression, response to treat-

ment, and possibly development of the disease, regard-

less of the presence of specific genetic abnormalities

in hematopoietic cells [10]. There is a large body of

evidence suggesting that B-ALL cells can modify the

bone marrow microenvironment creating conditions

conducive to the survival of malignant cells during

chemotherapy, leading to the disease recurrence. Leu-

kemic cells interact with components of the bone mar-

row microenvironment, including multipotent mesen-

chymal stromal cells(MSCs) [11]. Studying interactions

between the bone marrow microenvironment and

ALL cells has led to the discovery of potential thera-

peutic targets that include cytokines/chemokines and

their receptors, adhesion molecules, signal transduc-

tion pathways, and hypoxia-associated proteins [12].

Complex interactions between the leukemic cells and

components of the bone marrow microenvironment

lead to the involvement of MSCs in the suppression of

antitumor response, since these cells secrete cytokines

such as transforming growth factor-β (TGF-β) and he-

patocyte growth factor (HGF), which mediate suppres-

sion of T-cells [13].

Diffuse large B-cell lymphoma (DLBCL) is a hetero-

geneous group of diseases that differ in histological, im-

munohistochemical, and molecular characteristics[14].

LYMPHOID NEOPLASIA 885

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

In DLBCL, histological or molecular methods reveal

damage to the bone marrow only in 10-25% of pa-

tients [15]. It is believed that in the remaining patients

bone marrow is not involved in the malignant process.

However, bone marrow stromal progenitor cells in the

DLBCL patients without bone marrow involvement

are altered [16]. These changes cannot be attributed to

the contact interaction with tumor cells, as occurs in

leukemia [17, 18]. Many tumors secrete cytokines and

chemokines [19, 20], moreover, presence of a tumor

can be considered an inflammatory process [21, 22].

Inflammation is associated with active release of mul-

tiple factors that can activate cells of the bone marrow

stromal microenvironment, in particular MSCs [23].

MSCs activated by IL-1β, TNF, and IFN-γ secrete inhib-

itors and activators of the inflammatory process [24].

The aim of the study was to analyze the effect of

lymphoid neoplasia from early progenitor cells in di-

rect contact with the bone marrow stroma (ALL) and

more mature cells located exclusively extramedullary

(DLBCL) on immunological function of MSCs.

MATERIALS AND METHODS

Patient and donor bone marrow samples. Pa-

tient and donor samples were obtained in accordance

with the Declaration of Helsinki after the written in-

formed consent. The study was approved by the ethics

committee of the Federal State Budgetary Institution

National Medical Research Center for Hematology of

the Ministry of Health of the Russian Federation, pro-

tocol No.171 dated April27, 2023.

The work was performed with MSCs isolated from

the bone marrow of patients with ALL and DLBCL;

MSCs from the bone marrow of healthy donors were

used as controls. To account for the age difference,

two different donor groups were age-matched with

the patients with ALL and DLBCL. As such, the studied

parameters were normalized to the value of the corre-

sponding donor group median. Data on the number of

samples, patients, and healthy donors are presented

inTable1.

MSCs cultivation. Bone marrow was obtained

from the patients during diagnostic punctures and

from the hematopoietic stem cells donors during ex-

fusions after informed consent. To prevent clotting,

2-7 ml of bone marrow were placed in sterile tubes

with 1 ml of heparin (50  units/ml). The bone marrow

samples were diluted 2-fold with an α-MEM (ICN, Cana-

da) containing 0.2% methylcellulose (1500 cP, Sigma-Al-

drich, USA) and left for 40 min at room temperature.

Supernatant was collected and precipitated by centrif-

ugation at 450g for 10 min. Number of nuclear cells

was determined by counting after staining with gen-

tian violet solution (1% solution in 3% acetic acid) in a

Goryaev chamber. Cells (3×10

) were placed in a flask

with a bottom area of 25 cm

(Corning-Costar, USA)

Table 1. Characteristics of patients and donors

Diagnosis Group

Total number

of patients

Sex

Number

of patients

Age, years

Median

age, years

ALL

onset 31

male 15 19-72 29

female 16 18-55 31

remission 14

male 5 19-55 24

female 9 18-55 30

DLBCL

onset 40

male 14 30-78 48

female 26 34-79 60

remission 40

male 14 30-78 48

female 26 34-79 60

Healthy

donors

ALL 56

male 30

18-48 27

female 26

DLBCL 30

male 10

30-78 54

female 20

PETINATI et al.886

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

in 5 ml of complete α-MEM nutrient medium (ICN,

Canada) supplemented with 10% fetal bovine serum

(FBS) (Hyclone, USA), 2 mM L-glutamine (ICN, Cana-

da), 100 U/ml penicillin (Sintez, Russia), and 5  µg/ml

streptomycin (BioPharmGarant, Russia). MSCs were

cultivated at 37°C and 5% CO

. Culture medium was

changed twice a week. After reaching confluency,

the cells were passaged. To do this, the cells were

washed twice with 5ml of Versen’s solution and once

with 0.25 ml of 0.25% trypsin solution (PanEco, Rus-

sia). 0.25 ml of trypsin solution was added, and flasks

were left at room temperature until the cells detached

from the surface. The cells were resuspended in 1 ml

of the medium with FBS, and counted in 0.2% trypan

blue solution (Sigma-Aldrich) to determine their num-

ber and viability (trypan blue only stains dead cells).

During passage, 10

cells were seeded in a flask with a

bottom area of 25 cm

in 5 ml of the medium. Cultures

were maintained for 4 passages.

The time to P0 was defined as the number of days

from seeding bone marrow to reaching confluence for

the first time.

Calculation of cumulative cell production. Cu-

mulative cell production over 3 passages was calculat-

ed using the formula (1):

sum

= N0 + N0 · 

200000

 + N1 · 

200000

 + N2 · 

200000

 , (1)

where N0, N1, N2, and N3 are number of the cells re-

moved from 2 culture flasks at passages 0, 1, 2, and 3,

respectively.

Surface marker expression analysis by flow cy-

tometry. Surface phenotype of MSCs was studied at the

2nd passage by flow cytometry. After removing MSCs

from the flask, they were washed twice with CellWash

solution (BD Biosciences, USA) and then 2×10

cells

were incubated for 20 min in the dark with antibod-

ies. The antibody panels were as follows: 1) PE-labeled

anti-CD90 (5E10, BD Pharmingen, USA), FITC-labeled

anti-HLA-ABC (FN50, BioLegend, USA) and APC-labeled

anti-HLA-DR (L243, BioLegend); 2) anti-CD105, labeled

with FITC (43A3, BioLegend), anti-CD54, labeled with

APC (HA58, BioLegend), anti-CD146 PE-labeled (P1H12,

BD Pharmingen, USA); 3) PE-labeled anti-CD73 (AD2,

BD Pharmingen, USA). The analysis was performed

using a CytoFLEX flow cytometer (Beckman Coulter,

USA), data were analyzed with Kaluza Analysis 2.1

(Beckman Coulter). MSC population was determined

by forward and side light scattering. Mean fluores-

cence intensity (MFI) was assessed in APC, FITC, and

PE channels.

Relative level of gene expression analysis.

RNA isolation. To isolate RNA, the cells of the first

passage (10

-4.5×10

cells) were centrifuged at 300g.

The pellet was washed with 1 ml of phosphate buffer

and centrifuged at 300g. 400  µl of TriZol (Ambion by

Life Technologies, USA) was added to the pellet. Sam-

ples with TriZol were frozen at –70°C. After thawing,

120 µl of chloroform was added to the samples, after

which they were shaken, incubated for 2 min at room

temperature, and centrifuged for 15 min at 13,500g

and 4°C in a Centrifuge 5424 R (Eppendorf, Germany).

The resulting upper phase was transferred into new

tubes. 400 µl of isopropanol was added, the samples

were incubated for 10 min at room temperature and

centrifuged for 10 min at 13,500g and 4°C. The pellet

was washed with 1 ml of 75% ethanol, vortexed, and

centrifuged for 5 min at 13,500g at 4°C. The pellet

was left to dry for 5  min at room temperature. Next,

100 µl of DEPC-treated water was added to the pellet

and left for 30 min on ice for it to dissolve. After vor-

texing, 1 µl was taken to measure the amount of ex-

tracted RNA. The measurement was carried out with

a NanoDrop One spectrophotometer (Thermo Fisher

Scientific, USA) at a wavelength of 260 nm, RNA pu-

rity was determined by the ratio of 260/280 nm (it

should be in the range of 1.8-2.0). To the remaining

99 μl of the RNA solution, 10  μl of 3  M sodium acetate

and 250μl of 96% ethanol were added. Samples were

stored at –20°C.

cDNA synthesis. RNA in a mixture of ethanol and

sodium acetate was centrifuged for 10min at 13,500g

and 4°C. After that, the pellet was washed with 1 ml of

75% ethanol, mixed on a vortex, and centrifuged for

5 min at 13,500g and 4°C. The pellet was left to dry for

5 min at room temperature. 1  µl of DEPC-treated wa-

ter was added per 1 µg of RNA and the samples were

left on ice for 30 min for dissolution. Primers for re-

verse transcription (T13 primers and random hex-

amers) were annealed: 2 µl of RNA solution, 1.25  µl

of each primer (40 pmol/µl) and 5.5  µl of DEPC-treated

water were mixed, incubated in a Tertsik amplifier

(DNA-Technology) for 10  min at 70°C and 10 min at4°C.

After that, 15 μl of the reverse transcription mix

(5.5 µl milliQ water, 5 µl 5X M-MLV reversease buffer

(Promega, USA), 2.5 µl dNTPs mix, 1  µl each RNAsin

(Promega) and M-MLV reversease (Promega)) was add-

ed, and the samples were incubated in a Tertsik ampli-

fier at 42°C for 1 h. 75  μl of milliQ water were added.

The samples were stored at –20°C.

Real-time PCR. Real-time PCR in Taq-man modifi-

cation was performed with an AbiPrism Real Time PCR

System 7500 (Thermo Fisher Scientific) in a 96-well

plate; the reaction volume was 25µl. Each sample was

analyzed in triplicate; a positive control (a reference

mixture of cDNA from 117 donors) was used to assess

the quality of the reaction and correlate the results

of different PCRs, and a negative control was includ-

ed (water was added instead of cDNA). Sequences of

primers and probes are presented in Table  2. PCR re-

agents were mixed into a master mix (12.8 µl milliQ

water, 3.5 µl 25 mM  MgCl

(Thermo Fisher Scientific),

LYMPHOID NEOPLASIA 887

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Table 2. Primers and probes sequences

Gene Purpose Sequence

BACT forward primer CAACCGCGAGAAGATGACC

BACT reverse primer CAGAGGCGTACAGGGATAGC

BACT probe ROX-AGACCTTCAACACCCCAGCCATGTACG-BHQ2

GAPDH forward primer GGTGAAGGTCGGAGTCAACG

GAPDH reverse primer TGGGTGGAATCATATTGGAACA

GAPDH probe ROX-CTCTGGTAAAGTGGATATTGTTGCCATCA-BHQ2

VEGFA forward primer AGGCGAGGCAGCTTGAGTTA

VEGFA reverse primer ACCCTGAGGGAGGCTCCTT

VEGFA probe FAM-CCTCGGCTTGTCACATCTGCAAGTACGT-RTQ1

FGF2 forward primer GAAGAGCGACCCTCACATCAAG

FGF2 reverse primer TCCGTAACACATTTAGAAGCCAGTA

FGF2 probe FAM-TCATAGCCAGGTAACGGTTAGCACACACTCCT-RTQ1

IL6 forward primer ACCTGAACCTTCCAAAGATG

IL6 reverse primer CTCCAAAAGACCAGTGATGA

IL6 probe FAM-ATTCAATGAGGAGACTTGCCTGGTG-RTQ1

IL8 forward primer ACCATCTCACTGTGTGTAAAC

IL8 reverse primer GTTTGGAGTATGTCTTTATGC

IL8 probe FAM-CAGTTTTGCCAAGGAGTGCTAAAG-RTQ1

PDGFRB forward primer CTCCCTTATCATCCTCATCA

PDGFRB reverse primer TCCACGTAGATGTACTCATG

PDGFRB probe FAM-TCACAGACTCAATCACCTTCCATC-RTQ1

SPP1 forward primer ATAGTGTGGTTTATGGACTGAG

SPP1 reverse primer ATTCAACTCCTCGCTTTCC

SPP1 probe FAM-CCAGTACCCTGATGCTACAGACGAG-RTQ1

BGLAP forward primer GCAGCGAGGTAGTGAAGAG

BGLAP reverse primer GAAAGCCGATGTGGTCAG

BGLAP probe FAM-CTCCCAGCCATTGATACAGGTAGC-RTQ1

PPARG forward primer TACTGTCGGTTTCAGAAATGC

PPARG reverse primer CAACAGCTTCTCCTTCTCG

PPARG probe FAM-CCATCAGGTTTGGGCGGATGCC-RTQ1

FGFR1 forward primer CAGAATTGGAGGCTACAAGG

PETINATI et al.888

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Table 2 (cont.)

Gene Purpose Sequence

FGFR1 reverse primer TGATGCTGCCGTACTCATTC

FGFR1 probe FAM-CATCATAATGGACTCTGTGGTGC-RTQ1

FGFR2 forward primer CTCATTATGGAAAGTGTGGTC

FGFR2 reverse primer TGGGCCGGTGAGGCGATC

FGFR2 probe FAM-CAGGTGGTACGTGTGATTGATGGA-RTQ1

SOX9 forward primer AGCAAGACGCTGGGCAAG

SOX9 reverse primer GTTCTTCACCGACTTCCTC

SOX9 probe FAM-CTGGAGACTTCTGAACGAGAGC-RTQ1

SDF1 forward primer CTACAGATGCCCATGCCGAT

SDF1 reverse primer TAGCTTCGGGTCAATGCACA

SDF1 probe FAM-CAGTTTGGAGTGTTGAGAATTTTGAG-RTQ1

TGFB1 forward primer TGCGTCTGCTGAGGCTCAA

TGFB1 reverse primer CGGTGACATCAAAAGATAACC

TGFB1 probe FAM-AGGAATTGTTGCTGTATTTCTGGTAC-RTQ1

ICAM1 forward primer GCAATGTGCAAGAAGATAGC

ICAM1 reverse primer CTCCACCTGGCAGCGTAG

ICAM1 probe ROX-CACGGTGAGGAAGGTTTTAGCTGTT-RTQ2

2.5 µl 2.5  mM dNTPs mix, 2.5  µl 10X SmarTaq buffer

(Promega), 1 µl of forward and reverse primers each

(10 pmol/µl), 0.5  µl fluorescent probe (10 pmol/µl),

0.2  µl Taq polymerase (Promega) per reaction). 72 µl of

the master mix were placed into wells of a 96-well PCR

plate and 3 µl of the cDNA solution was added. The

samples were mixed and divided into 3 wells (25 µl

per well) to obtain triplicates. PCR started with 10-min

incubation at 95°C to activate the polymerase; 40 cy-

cles of PCR were performed for the BACT and GAPDH

genes, and 45 cycles for the remaining genes. Cycle pa-

rameters: 15 s at 95°C +  40 s at 60°C.

Calculation of relative gene expression level.

Relative expression level (REL) of genes was calculat-

ed using the modified ΔΔCt method [25]. The mean Ct

of three replicates was used for calculations. Ct is the

number of cycles required to reach the probe fluores-

cence threshold in PCR. For each gene, ΔCt was calcu-

lated using the formula(2):

ΔCt = Ct

sample

– Ct

control

. (2)

The RELs of the housekeeping genes (RELhk) –

BACT and GAPDH– were calculated using the formu-

la(3):

REL

= 2

–ΔCt

. (3)

Next, the sample normalization factor (NF) was

calculated using the formula (4):

NF =

√

REL

BACT

REL

GAPDH

. (4)

RELs for the genes of interest were calculated us-

ing the formula (5):

REL = 

−ΔCt

)

 . (5)

Secretome analysis. Preparation of MSCs con-

ditioned medium. MSCs at the passages 2-3 were

seeded at 4×10

cells per cm

in T175 flasks (Costar,

USA). After the cells reached confluence (3-4 days),

the flasks were washed 5 times with phosphate buffer

LYMPHOID NEOPLASIA 889

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

without Ca

/Mg

(Invitrogen, USA). The cells were

then cultured for 24 h in RPMI1640 medium without

serum and phenol red (HyClone). The conditioned me-

dium was centrifuged at 400g and frozen at –70°C.

Sample preparation for analysis. A protease in-

hibitor cocktail (Halt Protease Inhibitor Cocktail, Ther-

mo Fisher Scientific) was added to each sample, which

were then centrifuged at 1500g for 10  min to remove

debris. Supernatants were immediately frozen and ly-

ophilized to reduce volume. The lyophilized samples

were resuspended for 30 min in a buffer containing

6 M Gd-HCl, 10  mM  Tris-HCl (pH 8) and 2  mM DTT.

Toprecipitate the insoluble fraction, the solutions were

centrifuged at 16,000g for 10min at 4°C. Samples were

concentrated using a centrifuge filter (Corning Spin-X

UF6, Sigma-Aldrich) to replace the buffer. Buffer (8 M

urea, 2 M thiourea, 10  mM Tris-HCl (pH  = 8)) was add-

ed to the concentrated samples at a ratio of 1: 3 and

incubated at room temperature for 30 min. Disulfide

bonds were reduced with 5 mM  DTT at room tempera-

ture for 40  min and next alkylated with 10 mM iodoac-

etamide in the dark at room temperature for 20 min.

Alkylated samples were diluted by adding 50 mM

HCO

solution at a ratio of 1 :  4 followed by tryp-

sin addition (0.01 μg per 1 μg of protein) and incu-

bation at 37°C for 14 h. The reaction was stopped by

adding formic acid to a final concentration of 5%. The

peptides were desalted using Discovery DSC-18 tubes

(1 ml, 50  mg) (Sigma-Aldrich), dried under vacuum,

and stored at –80°C before analysis. Prior to LC-MS/MS,

samples were redissolved in 5% acetonitrile with 0.1%

trifluoroacetic acid and sonicated.

LC-MS/MS analysis. Analysis was performed us-

ing an Orbitrap Q Exactive HF-X mass spectrometer

equipped with a nano-ESI source and a high pressure

nanoflow chromatograph (UPLC Ultimate 3000) with a

C-18 (100µm) reverse phase column. ×300mm).

Bioinformatic processing of mass spectrome-

try data. Raw data from the mass spectrometer were

converted into .mgf files using MSConvert (ProteoWiz-

ard Software Foundation, USA) with the parameters

“--mgf --filter pickPicking true [1,2]”. To identify pro-

teins, a search was carried out using MASCOT (ver-

sion 2.5.1, Matrix Science Ltd., UK) and X!Tandem

(ALANINE, 2017.02.01, 2017.02.01, The Global Proteome

Machine Organization) in the UniProt human protein

database with concatenated backtrap dataset. Permis-

sible masses of the precursor and fragment were set to

20 ppm and 0.04  Da, respectively. Database search pa-

rameters included the following: tryptic digestion with

one possible gap [26], static modification for urea meth-

yl (C), and dynamic modifications for oxidation (M).

For X!Tandem, parameters were chosen that allowed

to quickly check for the acetylation of the N-terminal

residue of the protein, the loss of ammonia from the

N-terminal glutamine and water from the N-terminal

glutamic acid. The resulting files were processed in

Scaffold 5 (version 5.1.0). An algorithm for estimating

the local false discovery rate (FDR) with standard

grouping of proteins was used. To assess the hits of

peptides and proteins, FDR =  0.05 was chosen for both.

The samples annotated in the Swiss-Prot database were

marked as preferred.

Statistical analysis. Data sets are presented as in-

dividual values with indicated median. For each data

set, a normality test was performed using the Shapiro–

Wilk test (at p  < 0.05, the distribution was taken to be

different from normal). Significance of differences was

analyzed using Mann–Whitney test for non-normal

distributions. Differences were considered statistical-

ly significant at p  < 0.05. Statistical analysis was per-

formed using GraphPad Prism8.03.

RESULTS

Under the influence of lymphoid neoplasia, the

characteristics of MSCs change. Hematopoietic pro-

genitors that initiate tumor development in ALL and

DLBCL differ in the stage of differentiation: in ALL,

early bone marrow progenitors undergo tumor trans-

formation, while in DLBCL, it happens to more differ-

entiated B cells outside the bone marrow. MSCs only

from DLBCL patients without bone marrow involve-

ment were included in this study.

MSCs growth characteristics. Time required for

the MSCs of the patients at the onset of ALL to reach

P0 increased in comparison to the time required for

donor MSCs (p  < 0.0001), which may indirectly reflect

decrease in the number of stromal progenitor cells in

the bone marrow. Upon reaching remission, this pa-

rameter returned to normal. MSCs of the patients with

DLBCL did not differ from those of the healthy do-

nors at the onset of the disease, and in remission they

reached P0 faster than those of the donors (p  = 0.0107).

As a result, the time to P0 was longer in the cells from

the patients with ALL than in the MSCs from the pa-

tients with DLBCL at the onset of the disease (Fig.1a).

In remission, the time to P0 did not differ significantly.

Cumulative cell production of ALL patients’ MSCs

in 3 passages did not differ from that of the healthy

donors. When remission was achieved, total cell pro-

duction of patients with ALL increased significantly

compared to the donors (p  = 0.0419). Cumulative cell

production of the MSCs from the patients with DLBCL

increased in comparison to the donors’ MSCs both at

the onset (p  = 0.0119) and in remission of the disease

(p =  0.0011), and at the onset it was also significantly

higher than at the onset of ALL (Fig.1b).

Thus, we have shown that in ALL, the MSC growth

is suppressed before treatment and returns to nor-

mal in remission, while in DLBCL, on the contrary,

PETINATI et al.890

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Fig. 1. Time to passage 0 (P0)(a) and cumulative cell production in 3 passages(b) of MSCs from patients with ALL and DLBCL

before treatment and in remission normalized to age-matched donor MSCs’ median value. Data are presented as scatterplots

with indicated median. Horizontal red line indicates the median values of healthy donors’ cells.

the MSCs grow more actively than the cells from the

healthy donors. Other studied characteristics of the

MSCs from the patients differed from the donors’ cells

as well.

Membrane surface marker analysis. MSCs from

the bone marrow of the patients with hematological

diseases and the healthy donors differ in the expres-

sion of surface markers.

Mean fluorescence intensity (MFI) of the surface

markers was studied on the cells of 6 patients before

treatment of ALL and 3 in remission of ALL, 9 patients

before treatment and in remission of DLBCL, and 10

donors for each of the patient groups. According to the

International Society for Cellular Therapy (ISCT) crite-

ria, MSCs express CD90, CD105, and CD73 [27]. These

markers were present on all the studied cells, but their

MFIs differed between the groups (Fig. 2, a-c). CD73

MFI was significantly increased on the MSCs from the

patients with ALL before treatment compared to do-

nors’ (Fig. 2c). This parameter did not differ from the

donors neither at the onset nor in the remission of

DLBCL. However, in the remission of DLBCL MFI of

CD73 on the MSCs became significantly higher than it

was before treatment. The MSCs of patients with DLBCL

in remission had increased MFI of CD105 (Fig. 2b). Be-

fore the treatment of ALL, the observed expression

of HLA-ABC on the cells was significantly increased

compared to donors; in remission its MFI decreased

(Fig. 2d). Before the treatment of DLBCL, HLA-ABC

MFI on the cells did not differ from donors’, but in

the remission it significantly increased. The same ef-

fect was observed for the class II histocompatibility

molecules, HLA-DR, in DLBCL (Fig. 2e). Expression of

CD146 on the surface of the MSCs in the patients with

ALL demonstrated an upward trend compared to the

donors (Fig. 2f). In the patients with DLBCL, it did not

differ from the donors before treatment, but signifi-

cantly increased when remission was achieved. There

were no significant differences in the CD54 expression

between the studied groups except for a significant

increase in the patients in remission of DLBCL com-

pared to the donors (Fig. 2g).

Significant changes in the expression of MSC sur-

face markers were detected.

Changes in gene expression of factors import-

ant for immunoregulatory function of MSCs. Pat-

terns of the MSCs gene expression were studied. The

genes selected for analysis encode factors directly in-

volved in the regulation of immune response –  IL6,

IL8, TGFB1; homing and adhesion factors –  SDF1,

ICAM1; growth factors and their receptors –  FGF2,

FGFR1, FGFR2, PDGFRB, VEGFA. Expression pattern

of the MSC differentiation marker genes BGLAP, SPP1,

SOX9, and PPARG was studied as well, since the differ-

entiated descendants of MSCs– osteoblasts, adipocytes,

etc.– participate in immune regulation.

In the patients with ALL, expression of the IL6

gene in MSCs was significantly increased in compari-

son to the donors at the onset of the disease (p  < 0.0001)

and did not normalize after achieving remission

LYMPHOID NEOPLASIA 891

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Fig. 2. Mean fluorescence intensity (MFI) of the surface markers CD 90(a), CD 105 (b), CD 73 (c), HLA-ABC(d), HLA-DR (e),

CD146(f), and CD54(g) on the MSCs of patients with ALL and DLBCL, and healthy donors of corresponding ages. Yaxis shows

MFI fold change relative to the respective median value for the donor cells. Data are normalized to the median values for the

donor groups and presented as scatterplots with marked median.

(p <  0.0001), and in DLBCL it increased after chemo-

therapy compared with the onset of disease (Fig.  3a)

and the healthy donors (p =  0.0018). At the same time,

at the disease onset, IL6 gene expression was higher in

ALL than in DLBCL.

Additionally, at the onset of DLBCL increase in

the IL8 expression level relative to the healthy donors

(p  =  0.0220) was observed, and after treatment REL of

this gene increased even more (Fig. 3b). TGFB1 REL

was lowered in the MSCs of patients at the onset of

ALL compared to donor cells (p  = 0.004) and decreased

even more in remission (p  = 0.0002). In patients with

DLBCL there was also decrease in the REL of this gene

after treatment compared with the onset of the dis-

ease (Fig.3c). In the MSCs of the patients with DLBCL

at the onset and in the remission, the FGF2 REL was

increased compared to donors’ (p  = 0.0121, p =  0.0206,

respectively), at the onset of the disease it was sig-

nificantly higher than in the MSCs of ALL patients

(Fig. 3d). FGF2 receptors differed in their expres-

sion in the patients with ALL and DLBCL (Fig. 3,  e, f).

At the onset of DLBCL, the MSCs had reduced FGFR1

REL (p=0.0166) and increased FGFR2 REL (p  = 0.0017).

In the MSCs of the patients with ALL and DLBCL,

FGFR1 REL was insignificantly reduced at the onset

and remission of the disease, and FGFR2 expression