Article

ISSN 0006-2979, Biochemistry (Moscow), 2024, Vol. 89, No. 5, pp. 912-922 © Pleiades Publishing, Ltd., 2024.

912

Lymphocyte Phosphatase-Associated Phosphoprotein

(LPAP) as a CD45 Protein Stability Regulator

Natalia A. Kruglova

, Dmitriy V. Mazurov

, and Alexander V. Filatov

2,3,a

Center for Precision Genome Editing and Genetic Technologies for Biomedicine,

Institute of Gene Biology, Russian Academy of Sciences, 119334 Moscow, Russia

National Research Center Institute of Immunology,

Federal Medical Biological Agency of Russia, 115522 Moscow, Russia

Department of Immunology, Faculty of Biology, Lomonosov Moscow State University, 119234 Moscow, Russia

e-mail: avfilat@yandex.ru

Received November 5, 2023

Revised January 14, 2024

Accepted January 16, 2024

Abstract— Lymphocyte phosphatase-associated phosphoprotein (LPAP) is a binding partner of the phosphatase

CD45, but its function remains poorly understood. Its close interaction with CD45 suggests that LPAP may po-

tentially regulate CD45, but direct biochemical evidence for this has not yet been obtained. We found that in the

Jurkat lymphoid cells the levels of LPAP and CD45 proteins are interrelated and well correlated with each other.

Knockout of LPAP leads to the decrease in the surface expression of CD45, while its overexpression, on the con-

trary, caused its increase. No such correlation was found in the non-lymphoid K562 cells. We hypothesize that

LPAP regulates expression level of CD45 and thus can affect lymphocyte activation.

DOI: 10.1134/S0006297924050110

Keywords: LPAP, CD45, Tcell receptor, lymphocyte activation

Abbreviations: KO, knockout; LPAP, lymphocyte phosphatase-associated phosphoprotein; mKO, monoclonal culture with

knockout of the gene of interest; pKO, polyclonal culture with knockout of the gene of interest; PMA, phorbol-12-myri-

state-13-acetate; TCR,Tcell antigen-specific receptor.

* To whom correspondence should be addressed.

INTRODUCTION

Lymphocyte phosphatase-associated phosphopro-

tein (LPAP) was first described as a molecule bound to

the phosphatase CD45 [1]. CD45 protein plays an im-

portant role in lymphocyte activation, and it has been

studied quite well [2]. LPAP, unlike its partner, has not

been thoroughly studied. LPAP has no homologues in

the human proteome and its function is still unknown.

There is only indirect evidence of its role in T  cell ac-

tivation and B cell development [3]. Close association

of LPAP with the CD45 phosphatase and its multiple

phosphorylation, including the ERK-dependent Ser-163

phosphorylation, suggest that this protein is a partic-

ipant of the activation cascade [4,  5]. The CD45 mol-

ecule is able to regulate the Lck kinase required to

trigger activation cascade of lymphocytes after stim-

ulation of the T  cell antigen-specific receptor (TCR).

Byinteracting with CD45, LPAP can affect signal trans-

duction from the TCR in lymphocytes.

Formation of a tight complex between LPAP and

CD45 suggests that these proteins are functionally re-

lated. Since LPAP does not have phosphorylated ty-

rosines, it is not a direct substrate of CD45 phospha-

tase, which dephosphorylates only modified tyrosines.

There is some evidence that LPAP prevents formation

of CD45 dimers, which are characterized by lower

phosphatase activity than the monomeric form, and,

thus, indirectly regulates activity of CD45 [6].

Several observations have shown that the CD45

molecule is important for maintaining stability of

LPAP and its mouse homolog CD45-AP. First, in the lym-

phoid cell lines with knockdown of the phosphatase

CD45, the LPAP protein is synthesized, but is rapidly

LPAP REGULATES CD45 STABILITY 913

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

degraded [1]. Second, in the T cell line experiments

with induced CD45 expression, it was established that

accumulation of the LPAP protein begins only after ac-

tivation of the CD45 synthesis [7]. Knockdown of CD45

by shRNA reduces the level of LPAP protein [8]. Data

on the reverse effect of LPAP on CD45 are limited and

contradictory. In the lymphocytes of two LPAP-knock-

out mouse models, the level of CD45 was reduced [9,

10]. In the third LPAP knockout mouse line, this effect

was not observed [11], as well as in the Jurkat cells

with LPAP knockdown [12].

Some data indicate that the effects of CD45 on the

level of LPAP protein are carried out at the post-tran-

scriptional level [1,  13]. The Jurkat WT (CD45

) and

J45.01 (CD45

–

) cells have high levels of LPAP mRNA,

but the protein is detected only in the wild type Jurkat

cells. When the construct encoding CD45 was trans-

fected into the J45.01 cells, the level of LPAP protein

was restored [1]. Transcriptional analysis of the CD45

and CD45

–

variants of T cells has shown that produc-

tion of LPAP and CD45 mRNAs are regulated inde-

pendently [13].

Thus, the body of published data indicates exis-

tence of a relationship between the LPAP and CD45

protein levels. We have suggested that LPAP acts as

a chaperone for CD45 that controls stability and lev-

el of the CD45 protein. Jurkat cells with the CD45 or

LPAP knockouts and a series of cell lines with differ-

ent levels of the LPAP protein were produced to test

this assumption. These cell lines showed correlation

between the LPAP and CD45 protein levels. Existence

of correlation was confirmed in the clonal and poly-

clonal populations. Our results suggest that the LPAP

function could involve regulation of the CD45 expres-

sion in the cell.

MATERIALS AND METHODS

Cell culture, antibodies, and flow cytometry.

Jurkat and K562 cells were cultivated in a RPMI-1640

medium supplemented with 10% fetal calf serum,

4  mM L-glutamine, and gentamicin (80  mg/liter) (Pane-

co, Russia) at 37°C in a humidified atmosphere contain-

ing 5%  CO

. Mouse monoclonal antibodies CL7 (IgG2a,

anti-LPAP), LT45 (IgG2a, anti-CD45), EC101 (IgG1, anti-

CD59), MC7E7 (IgG1, anti-CD98) were produced previ-

ously in our laboratory [4]. Antibodies CD69-PE (Bio-

Legend, USA), OKT3 (eBioscience, USA), anti-Flag M2

(Sigma, USA) were also used.

For intracellular staining, 1 ml of PBS contain-

ing 1% paraformaldehyde was added to the cell pellet

and cells were incubated for 10  min at room tempera-

ture. The cells were next washed twice in PBS, the cell

pellet was resuspended in a permeabilization buffer

(PBS containing 0.1% saponin, 0.1% BSA, 0.05% NaN

The cells in the permeabilization buffer were mixed

with the antibody CL7-Alexa 594 or LT45-Alexa 594

and incubated for 30min, then the cells were washed

twice in the permeabilization buffer. Surface stain-

ing and washing were carried out in PBS. The stained

cells were analyzed with a CytoFLEXS flow cytometer

(Beckman Coulter, USA). The cells were sorted using

FACSAriaII (Becton Dickinson Biosciences, USA).

Generation of Jurkat cell lines with a double-

nicking knockout of LPAP or CD45 using CRISPR/Cas9

method. Two target sequences for PTPRCAP and PTPRC

genes encoding LPAP and CD45, respectively, were select-

ed using the online http://www.genome-engineering.org/

resource [14]. Oligonucleotides were synthesized in

the company Evrogen (Russia) (table).

Oligonucleotides were annealed and cloned

into a pKS-gRNA-BB vector at the BbsI restriction site

[15,  16]. To perform knockout, Jurkat cells (1.5 ×  10

)

were transfected using a Neon electroporation sys-

tem (Thermo Fisher Scientific, USA) according to the

manufacturer’s protocol. Electroporation mixture in a

buffer R contained 0.5 μg of plasmids encoding guide

RNAs gR-LPAP-1 and gR-LPAP-3 for LPAP knockout or

gRNA-CD45-1 and gRNA-CD45-2 for CD45 knockout, and

3 μg plasmids pcDNA3.3-Cas9 D10A (#41816, Addgene,

USA). In the case of LPAP knockout, cells were seed-

ed into a 96-well plate 24  h after transfection, tested

for LPAP expression three weeks later, and knockout

clones were selected. In the case of CD45 knockout, 5

days after transfection, CD45 expression in the cells

was assessed, and the CD45-negative population was

expanded and sorted.

Generation of LPAP knockout Jurkat cell lines

using the SORTS method. Knockout was performed

using the SORTS (Surface Oligopeptide knock-in for

Rapid Target Selection) method [17]. Briefly, principle

of the method was as follows. Using CRISPR/Cas9 tech-

nology, a short DNA construct was inserted into the

gene of the target protein (a process also called knock-

in), which blocked expression of the endogenous pro-

tein. At the same time, in the knockout cells, a marker

peptide was expressed on the plasma membrane. Pres-

ence of a label made it possible to select cells with a

knockout, and the use of two labels made it possible to

select cells with a knockout of two alleles. For this pur-

pose, two oligonucleotides with homology arms were

synthesized in the Evrogen company: 5′-2A-LPAP and

3′-2A-LPAP (table).

The resulting oligonucleotides were used as prim-

ers to obtain donor DNA. Plasmids pUCHR-mClover-

AID-P2A-CD5HA2-bglpA and pUCHR-mClover-AID-P2A-

CD5Flag2-bglpA, intended for introducing into the cell

genome constructs encoding the HA or Flag peptide

tag, respectively, were used as templates for PCR [17].

PCR products were run on a 1% agarose gel, a frag-

ment of approximately 450  bp was excised, and then

KRUGLOVA et al.914

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Oligonucleotides for PTPRCAP and PTPRC gRNAs

Name Sequence

5′-gR-LPAP-1 CACCGCATCCCGAGCCCTAAGGTGC

3′-gR-LPAP-1 AAACGCACCTTAGGGCTCGGGATGC

5′-gR-LPAP-3 CACCGCGCTGCCACCCGAGCCCAAG

3′-gR-LPAP-3 AAACCTTGGGCTCGGGTGGCAGCGC

5′-gRNA-CD45-1 CACCGAAATGACAGCGCTTCCAGAA

3′-gRNA-CD45-1 AAACTTCTGGAAGCGCTGTCATTTC

5′-gRNA-CD45-2 CACCGAGGTGATATTACCCTCAGTC

3′-gRNA-CD45-2 AAACGACTGAGGGTAATATCACCTC

5′-2A-LPAP

CGAAAGTGGTCTTGGTCACCCAGCCTGCCCCACACCAGGCCCCACCCCAGGTGCTGAGCCCTCTG

AGCCCCTGCCTGTCTCCCACAGGCTCTGCCCTGCGGATCCGGCGCAACAAAC

3′-2A-LPAP

GGCGGCGCCAGGCCAGTGCTAGGCCAGTGGCCAGCAGTAGGAGCAGCAGCAGCAGCAGGACAA

CGGTGACAGAGCTGGAGCCCACGCTGTCCTCCGCACACAAAAAACCAACACAC

Note. Sequences of homology arms are underlined, and regions of complementarity to the template plasmid are highlight-

ed in bold.

isolated from the gel using a GeneJET Gel Extraction

Kit (#K0692, Thermo Fisher Scientific) according to the

manufacturer’s instructions. Product concentrations

were measured using a NanoDrop-2000 spectropho-

tometer (Thermo Fisher Scientific).

To perform knockout, Jurkat cells (1.5 ×  10

) were

transfected using a Neon electroporation system as

described above. Electroporation mixture in a buffer

R contained 0.5  μg of plasmids encoding guide RNAs

gR-LPAP-1 and gR-LPAP-3, 3 μg of plasmid pcDNA3.3-

Cas9 D10A (#41816, Addgene), 0.4 μg of a donor DNA

(purified PCR product, see above) encoding the HA tag,

and 0.7  μg of a donor DNA encoding the Flag-tag. Five

days after transfection, cells were tested for effective-

ness of mono- and biallelic knockin based on expres-

sion of HA and Flag epitope tags using flow cytometry.

Cells were expanded and several rounds of positive

population sorting were performed. For simplicity, the

resulting cells were designated as LPAP

pKO

(polyclonal

knockout).

Generation of cell lines with stable expression

of LPAP. HEK293T cells were seeded at 0.1 million per

well of a 24-well plate, and after a day of cultivation,

transfection was performed using a Lipofectamine

2000 reagent (Invitrogen, USA). For this, three plas-

mids were used: 0.87  μg of a HIV-1 packaging vector

pCMVΔ8.2R (#12263, Addgene), 1.3 μg of a pUCHR-LPAP-

wt transfer vector, 0.27 μg of a pCMV VSVG plasmid

(#  8454, Addgene), encoding protein G from vesicular

stomatitis virus. After 6  h, the medium was changed;

after 48 hours, the supernatant was collected and fil-

tered through a 0.45-μm filter. For transduction, target

cells were seeded at 0.1 million per well of a 24-well

plate and 250  μl of supernatant containing lentivirus

was added. After 2 days, transduction efficiency was

assessed using flow cytometry. The pool of transduced

cells was cloned, and the clones were tested using flow

cytometry.

Cell activation. Cells were activated by adding

10  ng/ml phorbol-12-myristate-13-acetate (PMA, Sigma,

USA) followed by 4  h cultivation. Alternatively, cells

were activated by culturing for 24 h in plates with

wells pre-coated with anti-CD3 antibody OKT3 (eBio-

science, USA) at a concentration of 0.1 to 10  μg/ml. Ac-

tivation was stopped by adding cold PBS to the cells.

Immunoprecipitation. Cells were suspended in

a cold lysis buffer containing 1%  (w/v)  Triton X-100,

20  mM  Tris-HCl (pH  8.0), 150  mM  NaCl, 5  mM  EDTA,

1  mM phenylmethylsulfonyl fluoride, 10  mM  NaF, and

1  mM sodium orthovanadate (all reagents from Merck,

USA). After 30 min of incubation on ice, nuclei and in-

soluble cell membranes were removed by centrifuga-

tion for 30  min at 4°C (20,000g). Immunoprecipitation

was performed using CL7 or LT45 antibody covalently

immobilized on an AffiGel-Hz carrier (Bio-Rad, USA).

Immunoprecipitates were washed three times in a ly-

sis buffer, the protein was eluted in a sample buffer

for SDS-PAGE (62.5 mM  Tris-HCl, pH  6.8, 10%  glycerol,

2%  SDS, 1%  2-mercaptoethanol, and 0.05%  bromophe-

nol blue) by heating for 5min at 80°C.

Electrophoresis and Western blotting (WB).

Eluted proteins were separated using electrophoresis

LPAP REGULATES CD45 STABILITY 915

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

in 10 or 18% polyacrylamide gel in the presence of so-

dium dodecyl sulfate (SDS-PAGE) under reducing con-

ditions in a Laemmli buffer system. After SDS-PAGE,

proteins were transferred to a PVDF membrane using

a semi-dry method. The membrane was blocked with

5%  dry skim milk in PBS supplemented with 0.1%

Tween20. Antigens were detected using primary and

then secondary antibodies against mouse IgG labeled

with horseradish peroxidase (GE Healthcare, USA).

The signal was detected with a ChemiDoc XRS System

(Bio-Rad) using chemiluminescence reagents from

Millipore (USA).

Statistical data processing. For statistical analy-

sis and data visualization, the GraphPad Prism8 pro-

gram (GraphPad Software, USA) was used. Data were

compared using a one-sample t-test. Results are shown

as a mean  ±  standard deviation (SD). Correlation was

assessed using the nonparametric Spearman test.

RESULTS

Levels of LPAP and CD45 proteins decrease in

the absence of the partner protein. It was previously

found that in the absence of CD45 phosphatase, the lev-

el of LPAP in the cell decreases [1]. At the same time,

data on the reverse effect of LPAP on CD45 expression

are contradictory. In order to evaluate mutual influ-

ence of these two proteins, we generated the CD45 or

LPAP knockout Jurkat cell lines using the CRISPR/Cas9

technology.

It was found that in the CD45 knockout Jurkat

T  cell line, the level of LPAP was only 10% of the amount

of the protein in the parental line, which correspond-

ed to the level of autofluorescence of the wild-type

cells (Fig.1,a,b). To examine relationship between the

LPAP and CD45 expression in more detail, we gener-

ated a panel of the Jurkat LPAP

sublines using two

Fig. 1. Levels of LPAP and CD45 proteins decrease in the absence of a partner protein. a)Representative cytograms of LPAP ex-

pression on the wild-type (WT) Jurkat cells, as well as on the CD45

or LPAP

cells. b)LPAP expression based on the results of

testing 7 CD45

clones; c, d) Expression of CD45 and “irrelevant” proteins CD59 and CD98 in the Jurkat LPAP

mKO

(c) or LPAP

pKO

(d)

cultures. Protein expression levels of LPAP, CD45, CD59 and CD98 were determined using flow cytometry. Normalized CD45 ex-

pression level was compared with a reference value of 100 using a one-sample Student’s t-test(b). To compare protein levels in

the wild-type and knockout cells, ANOVA was used with posthoc analysis using Tukey’s test (c, d). ****p<0.0001.

KRUGLOVA et al.916

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

different approaches. First, we used the “tradition-

al” method of knocking out the LPAP gene using the

CRISPR/Cas9 technology, and after subsequent cloning

we obtained a series of monoclonal cultures of Jur-

kat LPAP

(hereinafter referred to as LPAP

mKO

). And

next, using the recently developed SORTS method [18],

we obtained a polyclonal Jurkat population with the

knockout of LPAP (hereinafter referred to as LPAP

pKO

The second approach has some advantages. Firstly, the

Jurkat cell line is heterogeneous, and when working

with individual clones of this line, there is a high risk

that the observed phenotype is due to characteristics

of a particular clone, and not to the experimental im-

pact. Secondly, it has been shown that the cell clones

can be very different from both the parental popula-

tion and polyclonal population of the sorted knockout

cells due to consolidation of the off-target genomic

changes [17-19].

In all Jurkat LPAP

mKO

cultures, the CD45 expres-

sion was reduced to 30% of the wild-type level (Fig.1c).

The CD45 level in the Jurkat LPAP

pKO

cells was 37% of

the CD45 level in the wild-type cells (Fig. 1d). Agree-

ment between the data obtained for the individual

clones and for the polyclonal population allows us to

exclude contribution of interclonal variability to the

observed phenotype. As a control, we used the CD59

and CD98 molecules as “irrelevant” proteins, for which

there is no data on their interaction with LPAP. The level

of “irrelevant” proteins CD59 and CD98 also decreased,

but to a significantly lesser extent than CD45 (Fig.  1c;

p  <  0.0001). This indicates specific nature of the decrease

in the CD45 protein level in the LPAP knockout cells.

CD45 expression correlates with the level of

LPAP. After we discovered that the LPAP knockout

resulted in the decrease in the CD45 protein level, we

decided to investigate whether restoration of the level

of LPAP in the cells could increase the phosphatase ex-

pression. For this purpose, we selected one of the Jur-

kat LPAP

mKO

clones and introduced the gene encoding

LPAP

into it using stable lentiviral transduction. The

resulting population was then cloned and the effect of

restoration of the expression of LPAP and CD45 pro-

teins was assessed using flow cytometry. When testing

21 Jurkat subclones, we found high level of correlation

between the CD45 and LPAP expression (Spearman

correlation coefficient r  =  0.77, p  <  0.0001) (Fig.  2a).

In contrast, for the clones tested, there was no signif-

icant correlation between the LPAP expression and

expression of the irrelevant protein CD98 (r  = 0.02)

(Fig.2b). As an additional control, we used the Jurkat

WT clones, in which there was also no correlation be-

tween the levels of LPAP and CD45 (Fig.  2c). This con-

trol shows that the correlation shown in Fig.2a is not

the result of a cloning procedure.

Since the described result was shown in the cells

derived from a single Jurkat LPAP

clone and could

be due to characteristics of the randomly selected clone,

we decided to verify the results with the data obtained

from a polyclonal knockout. For this purpose, the gene

encoding LPAP

, or the GFP gene in the control sam-

ple, was introduced into the Jurkat LPAP

pKO

cells by

lentiviral transduction. During transduction, three in-

creasing doses of the virus were used (#1, #2, #3), after

which expression of LPAP and CD45 in the resulting

cultures was analyzed using flow cytometry. With in-

crease of the LPAP level (Fig.2d), the amount of CD45

in the cells also increased (Fig.  2,  e,  f). Difference be-

tween the levels of surface and total CD45 observed

in the pKO cells did not change upon re-expression

of LPAP (Fig.  2e). This indicates that in the absence

of LPAP, CD45 is degraded and is not retained and ac-

cumulated in the vesicular system of the cell.

In the cells with enhanced LPAP expression

the CD45 level increases. In the previous step, we

found correlation between the LPAP and CD45 levels

in the Jurkat cells with the LPAP levels ranging from

0% to 100% and CD45 levels ranging from 30% to

100%, relative to their endogenous expression levels.

However, the question arises whether this correla-

tion would persist with further increase in the level

of LPAP in the cells. Using lentiviral transduction, a

construct containing the LPAP-Flag-IRES-GFP cassette

was introduced into the Jurkat cells. After two rounds

of GFP

cell sorting, the level of LPAP increased mark-

edly (Fig.  3a). In order to distinguish between the

endogenous LPAP and exogenous LPAP-Flag, electro-

phoresis was performed in the 18% PAAG. Increase

in the intensity of the band with the increased mo-

lecular weight was observed, which corresponded to

the LPAP protein with the Flag peptide tag, compared

with the intensity of the endogenous LPAP bands

(Fig.3b).

We hypothesized that in the Jurkat lymphoid cells

there is a special mechanism for homeostatic regula-

tion of LPAP levels, which cannot be bypassed by len-

tiviral transduction. Then we took the K562 cells of the

erythromyeloid lineage, which carry CD45 on the sur-

face, but are practically devoid of the endogenous LPAP

(MFI  =  3000). After lentiviral transduction, the K562

cells expressed high levels of LPAP-Flag (MFI  =  116,000)

(Fig.  3c). At the same time, the CD45 protein level also

increased 3.1-fold (Fig.  3d). Thus, both the increased

LPAP expression and its ectopic expression led to the

increased CD45 expression.

LPAP knockout reduces CD3-induced expres-

sion of the activation molecule CD69. One of the ear-

ly manifestations of T cell activation is upregulation of

the CD69 protein exposure on the plasma membrane.

In order to evaluate possible contribution of LPAP to

intracellular signal transduction, we compared expres-

sion of the CD69 molecule on the Jurkat WT and Jurkat

LPAP

pKO

cells upon activation with PMA or antibodies

LPAP REGULATES CD45 STABILITY 917

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Fig. 2. CD45 levels correlate with LPAP protein levels. a,b)Correlation between the levels of LPAP and CD45(a) or LPAP and

CD98(b) in the Jurkat LPAP

clones with LPAP

re-expression. c)Correlation between LPAP and CD45 levels in the Jurkat

LPAP

clones; d,e) LPAP (d) and CD45 (e) levels in the Jurkat LPAP

pKO

cells stably transduced with the increasing doses of

virus to re-express LPAP

(#1, #2, #3) or express GFP. LPAP expression is normalized to the expression in the Jurkat LPAP

cells. ForCD45, values are shown for the surface (sCD45) and total (tCD45) levels. f)Correlation between LPAP and CD45 levels

in the Jurkat LPAP

clones stably transfected with LPAP

. Expression levels were determined from MFI values, which were

normalized to the Jurkat WT mean expression after subtracting the background level in the Jurkat CD45

or Jurkat LPAP

cells. Individual values as well as mean values ±SD are shown. Normalized expression level of LPAP in the transduced cells

was compared with the value of zero in the GFP-expressing cells using a one-sample Student’s t-test(d). ANOVA with posthoc

analysis using Tukey’s test was used to compare surface(s) and total(t) CD45 levels in the Jurkat LPAP

pKO

cells and transducers.

***p<0.001, ****p<0.0001. Mean values for LPAP and sCD45 levels from(e) were used to calculate the correlation(f).

against the CD3 receptor. When stimulated with PMA,

the pKO cells expressed 40% less CD69 molecules than

the wild-type cells (Fig.4a). We then used a more phys-

iological stimulus, CD3 cross-linking using the OKT3

antibody. Since the CD69 expression on the OKT3-ac-

tivated Jurkat cells has a bimodal distribution (Fig.4b,

left panel), we compared the LPAP knockout cells and

the wild-type cells by two parameters: percentage of

the activated cells and MFI of the CD69

cells from the

population with high level of CD69 (gating to the corre-

sponding populations is shown in Fig.4b, middle and

right panels).

KRUGLOVA et al.918

BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024

Fig. 3. In the cells with enhanced expression of LPAP, the level of CD45 increases. a,b)Level of LPAP protein was analyzed in

the Jurkat and Jurkat LPAP-Flag cell lines after the first and second sorting (sort1 and sort2). Cells were lysed, LPAP or CD45

proteins were isolated by immunoprecipitation (IP), samples were separated by electrophoresis on a 12%(a) or 18%(b) gel, and

Western blotting was performed with the indicated antibodies. The lower blot(b) was stained with antibodies against Flag and

LPAP. The LPAP and LPAP-Flag bands are indicated by arrows. c,d)Expression of LPAP and CD45 on the surface of wild-type

K562 cells, as well as of the cells stably transduced with LPAP-Flag.

Jurkat cells are characterized by low level of CD3

expression, which is detected only on some cells. Wehy-

pothesize that these CD3

cells respond to stimulation

with the OKT3 antibody, resulting in the bimodal dis-

tribution of CD69. When activated via CD3, a significant

difference between the Jurkat WT and LPAP

pKO

cells

was observed in the samples with high concentration of

OKT3 (1 and 10  μg/ml). Moreover, in the case of the pKO

population, almost all cells were activated, but the lev-

el of CD69 on them was reduced compared to the wild-

type cells (Fig.  4b, left panel). This difference could be

due to the different levels of CD3 on the two cell types

(Fig.  4c, left panel). In the pKO population, percentage of

the CD3

-positive cells was higher (Fig.  4c, middle pan-

el), while MFI of the CD3

-positive population was low-

er compared to the wild-type cells (Fig.  4c, right panel),

which is consistent with the result for CD69 expression.

DISCUSSION

Role of the LPAP protein in the cell remains un-

known, but formation of a tight complex with CD45 in-

dicates that the LPAP function may be associated with

regulation of this phosphatase. Changes in the phos-

phorylation status of LPAP upon T cell activation sug-

gest that LPAP is a participant of the Tcell lymphocyte

receptor signaling cascade [5].

Some studies suggest that the CD45 phosphatase is

required to maintain LPAP stability [7,  13]. This is in

good agreement with our data that in the CD45 knock-

out Jurkat cells, the level of LPAP decreases by 90%.

We previously showed that the knockdown of CD45

using shRNA reduced LPAP expression by more than

twofold [8]. Finally, the Jurkat-derived cell line J45.01,

which has only 5-8% of CD45 [20], expresses three