ISSN 0006-2979, Biochemistry (Moscow), 2024, Vol. 89, No. 5, pp. 912-922 © Pleiades Publishing, Ltd., 2024.
912
Lymphocyte Phosphatase-Associated Phosphoprotein
(LPAP) as a CD45 Protein Stability Regulator
Natalia A. Kruglova
1
, Dmitriy V. Mazurov
2
, and Alexander V. Filatov
2,3,a
*
1
Center for Precision Genome Editing and Genetic Technologies for Biomedicine,
Institute of Gene Biology, Russian Academy of Sciences, 119334 Moscow, Russia
2
National Research Center Institute of Immunology,
Federal Medical Biological Agency of Russia, 115522 Moscow, Russia
3
Department of Immunology, Faculty of Biology, Lomonosov Moscow State University, 119234 Moscow, Russia
a
e-mail: avfilat@yandex.ru
Received November 5, 2023
Revised January 14, 2024
Accepted January 16, 2024
Abstract— Lymphocyte phosphatase-associated phosphoprotein (LPAP) is a binding partner of the phosphatase
CD45, but its function remains poorly understood. Its close interaction with CD45 suggests that LPAP may po-
tentially regulate CD45, but direct biochemical evidence for this has not yet been obtained. We found that in the
Jurkat lymphoid cells the levels of LPAP and CD45 proteins are interrelated and well correlated with each other.
Knockout of LPAP leads to the decrease in the surface expression of CD45, while its overexpression, on the con-
trary, caused its increase. No such correlation was found in the non-lymphoid K562 cells. We hypothesize that
LPAP regulates expression level of CD45 and thus can affect lymphocyte activation.
DOI: 10.1134/S0006297924050110
Keywords: LPAP, CD45, Tcell receptor, lymphocyte activation
Abbreviations: KO, knockout; LPAP, lymphocyte phosphatase-associated phosphoprotein; mKO, monoclonal culture with
knockout of the gene of interest; pKO, polyclonal culture with knockout of the gene of interest; PMA, phorbol-12-myri-
state-13-acetate; TCR,Tcell antigen-specific receptor.
* To whom correspondence should be addressed.
INTRODUCTION
Lymphocyte phosphatase-associated phosphopro-
tein (LPAP) was first described as a molecule bound to
the phosphatase CD45 [1]. CD45 protein plays an im-
portant role in lymphocyte activation, and it has been
studied quite well [2]. LPAP, unlike its partner, has not
been thoroughly studied. LPAP has no homologues in
the human proteome and its function is still unknown.
There is only indirect evidence of its role in T  cell ac-
tivation and B cell development [3]. Close association
of LPAP with the CD45 phosphatase and its multiple
phosphorylation, including the ERK-dependent Ser-163
phosphorylation, suggest that this protein is a partic-
ipant of the activation cascade [4,  5]. The CD45 mol-
ecule is able to regulate the Lck kinase required to
trigger activation cascade of lymphocytes after stim-
ulation of the T  cell antigen-specific receptor (TCR).
Byinteracting with CD45, LPAP can affect signal trans-
duction from the TCR in lymphocytes.
Formation of a tight complex between LPAP and
CD45 suggests that these proteins are functionally re-
lated. Since LPAP does not have phosphorylated ty-
rosines, it is not a direct substrate of CD45 phospha-
tase, which dephosphorylates only modified tyrosines.
There is some evidence that LPAP prevents formation
of CD45 dimers, which are characterized by lower
phosphatase activity than the monomeric form, and,
thus, indirectly regulates activity of CD45 [6].
Several observations have shown that the CD45
molecule is important for maintaining stability of
LPAP and its mouse homolog CD45-AP. First, in the lym-
phoid cell lines with knockdown of the phosphatase
CD45, the LPAP protein is synthesized, but is rapidly
LPAP REGULATES CD45 STABILITY 913
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
degraded [1]. Second, in the T cell line experiments
with induced CD45 expression, it was established that
accumulation of the LPAP protein begins only after ac-
tivation of the CD45 synthesis [7]. Knockdown of CD45
by shRNA reduces the level of LPAP protein [8]. Data
on the reverse effect of LPAP on CD45 are limited and
contradictory. In the lymphocytes of two LPAP-knock-
out mouse models, the level of CD45 was reduced [9,
10]. In the third LPAP knockout mouse line, this effect
was not observed [11], as well as in the Jurkat cells
with LPAP knockdown [12].
Some data indicate that the effects of CD45 on the
level of LPAP protein are carried out at the post-tran-
scriptional level [1,  13]. The Jurkat WT (CD45
+
) and
J45.01 (CD45
–
) cells have high levels of LPAP mRNA,
but the protein is detected only in the wild type Jurkat
cells. When the construct encoding CD45 was trans-
fected into the J45.01 cells, the level of LPAP protein
was restored [1]. Transcriptional analysis of the CD45
+
and CD45
–
variants of T cells has shown that produc-
tion of LPAP and CD45 mRNAs are regulated inde-
pendently [13].
Thus, the body of published data indicates exis-
tence of a relationship between the LPAP and CD45
protein levels. We have suggested that LPAP acts as
a chaperone for CD45 that controls stability and lev-
el of the CD45 protein. Jurkat cells with the CD45 or
LPAP knockouts and a series of cell lines with differ-
ent levels of the LPAP protein were produced to test
this assumption. These cell lines showed correlation
between the LPAP and CD45 protein levels. Existence
of correlation was confirmed in the clonal and poly-
clonal populations. Our results suggest that the LPAP
function could involve regulation of the CD45 expres-
sion in the cell.
MATERIALS AND METHODS
Cell culture, antibodies, and flow cytometry.
Jurkat and K562 cells were cultivated in a RPMI-1640
medium supplemented with 10% fetal calf serum,
4  mM L-glutamine, and gentamicin (80  mg/liter) (Pane-
co, Russia) at 37°C in a humidified atmosphere contain-
ing 5%  CO
2
. Mouse monoclonal antibodies CL7 (IgG2a,
anti-LPAP), LT45 (IgG2a, anti-CD45), EC101 (IgG1, anti-
CD59), MC7E7 (IgG1, anti-CD98) were produced previ-
ously in our laboratory [4]. Antibodies CD69-PE (Bio-
Legend, USA), OKT3 (eBioscience, USA), anti-Flag M2
(Sigma, USA) were also used.
For intracellular staining, 1 ml of PBS contain-
ing 1% paraformaldehyde was added to the cell pellet
and cells were incubated for 10  min at room tempera-
ture. The cells were next washed twice in PBS, the cell
pellet was resuspended in a permeabilization buffer
(PBS containing 0.1% saponin, 0.1% BSA, 0.05% NaN
3
).
The cells in the permeabilization buffer were mixed
with the antibody CL7-Alexa 594 or LT45-Alexa 594
and incubated for 30min, then the cells were washed
twice in the permeabilization buffer. Surface stain-
ing and washing were carried out in PBS. The stained
cells were analyzed with a CytoFLEXS flow cytometer
(Beckman Coulter, USA). The cells were sorted using
FACSAriaII (Becton Dickinson Biosciences, USA).
Generation of Jurkat cell lines with a double-
nicking knockout of LPAP or CD45 using CRISPR/Cas9
method. Two target sequences for PTPRCAP and PTPRC
genes encoding LPAP and CD45, respectively, were select-
ed using the online http://www.genome-engineering.org/
resource [14]. Oligonucleotides were synthesized in
the company Evrogen (Russia) (table).
Oligonucleotides were annealed and cloned
into a pKS-gRNA-BB vector at the BbsI restriction site
[15,  16]. To perform knockout, Jurkat cells (1.5 ×  10
6
)
were transfected using a Neon electroporation sys-
tem (Thermo Fisher Scientific, USA) according to the
manufacturer’s protocol. Electroporation mixture in a
buffer R contained 0.5 μg of plasmids encoding guide
RNAs gR-LPAP-1 and gR-LPAP-3 for LPAP knockout or
gRNA-CD45-1 and gRNA-CD45-2 for CD45 knockout, and
3 μg plasmids pcDNA3.3-Cas9 D10A (#41816, Addgene,
USA). In the case of LPAP knockout, cells were seed-
ed into a 96-well plate 24  h after transfection, tested
for LPAP expression three weeks later, and knockout
clones were selected. In the case of CD45 knockout, 5
days after transfection, CD45 expression in the cells
was assessed, and the CD45-negative population was
expanded and sorted.
Generation of LPAP knockout Jurkat cell lines
using the SORTS method. Knockout was performed
using the SORTS (Surface Oligopeptide knock-in for
Rapid Target Selection) method [17]. Briefly, principle
of the method was as follows. Using CRISPR/Cas9 tech-
nology, a short DNA construct was inserted into the
gene of the target protein (a process also called knock-
in), which blocked expression of the endogenous pro-
tein. At the same time, in the knockout cells, a marker
peptide was expressed on the plasma membrane. Pres-
ence of a label made it possible to select cells with a
knockout, and the use of two labels made it possible to
select cells with a knockout of two alleles. For this pur-
pose, two oligonucleotides with homology arms were
synthesized in the Evrogen company: 5′-2A-LPAP and
3′-2A-LPAP (table).
The resulting oligonucleotides were used as prim-
ers to obtain donor DNA. Plasmids pUCHR-mClover-
AID-P2A-CD5HA2-bglpA and pUCHR-mClover-AID-P2A-
CD5Flag2-bglpA, intended for introducing into the cell
genome constructs encoding the HA or Flag peptide
tag, respectively, were used as templates for PCR [17].
PCR products were run on a 1% agarose gel, a frag-
ment of approximately 450  bp was excised, and then
KRUGLOVA et al.914
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Oligonucleotides for PTPRCAP and PTPRC gRNAs
Name Sequence
5′-gR-LPAP-1 CACCGCATCCCGAGCCCTAAGGTGC
3′-gR-LPAP-1 AAACGCACCTTAGGGCTCGGGATGC
5′-gR-LPAP-3 CACCGCGCTGCCACCCGAGCCCAAG
3′-gR-LPAP-3 AAACCTTGGGCTCGGGTGGCAGCGC
5′-gRNA-CD45-1 CACCGAAATGACAGCGCTTCCAGAA
3′-gRNA-CD45-1 AAACTTCTGGAAGCGCTGTCATTTC
5′-gRNA-CD45-2 CACCGAGGTGATATTACCCTCAGTC
3′-gRNA-CD45-2 AAACGACTGAGGGTAATATCACCTC
5′-2A-LPAP
CGAAAGTGGTCTTGGTCACCCAGCCTGCCCCACACCAGGCCCCACCCCAGGTGCTGAGCCCTCTG
AGCCCCTGCCTGTCTCCCACAGGCTCTGCCCTGCGGATCCGGCGCAACAAAC
3′-2A-LPAP
GGCGGCGCCAGGCCAGTGCTAGGCCAGTGGCCAGCAGTAGGAGCAGCAGCAGCAGCAGGACAA
CGGTGACAGAGCTGGAGCCCACGCTGTCCTCCGCACACAAAAAACCAACACAC
Note. Sequences of homology arms are underlined, and regions of complementarity to the template plasmid are highlight-
ed in bold.
isolated from the gel using a GeneJET Gel Extraction
Kit (#K0692, Thermo Fisher Scientific) according to the
manufacturer’s instructions. Product concentrations
were measured using a NanoDrop-2000 spectropho-
tometer (Thermo Fisher Scientific).
To perform knockout, Jurkat cells (1.5 ×  10
6
) were
transfected using a Neon electroporation system as
described above. Electroporation mixture in a buffer
R contained 0.5  μg of plasmids encoding guide RNAs
gR-LPAP-1 and gR-LPAP-3, 3 μg of plasmid pcDNA3.3-
Cas9 D10A (#41816, Addgene), 0.4 μg of a donor DNA
(purified PCR product, see above) encoding the HA tag,
and 0.7  μg of a donor DNA encoding the Flag-tag. Five
days after transfection, cells were tested for effective-
ness of mono- and biallelic knockin based on expres-
sion of HA and Flag epitope tags using flow cytometry.
Cells were expanded and several rounds of positive
population sorting were performed. For simplicity, the
resulting cells were designated as LPAP
pKO
(polyclonal
knockout).
Generation of cell lines with stable expression
of LPAP. HEK293T cells were seeded at 0.1 million per
well of a 24-well plate, and after a day of cultivation,
transfection was performed using a Lipofectamine
2000 reagent (Invitrogen, USA). For this, three plas-
mids were used: 0.87  μg of a HIV-1 packaging vector
pCMVΔ8.2R (#12263, Addgene), 1.3 μg of a pUCHR-LPAP-
wt transfer vector, 0.27 μg of a pCMV VSVG plasmid
(#  8454, Addgene), encoding protein G from vesicular
stomatitis virus. After 6  h, the medium was changed;
after 48 hours, the supernatant was collected and fil-
tered through a 0.45-μm filter. For transduction, target
cells were seeded at 0.1 million per well of a 24-well
plate and 250  μl of supernatant containing lentivirus
was added. After 2 days, transduction efficiency was
assessed using flow cytometry. The pool of transduced
cells was cloned, and the clones were tested using flow
cytometry.
Cell activation. Cells were activated by adding
10  ng/ml phorbol-12-myristate-13-acetate (PMA, Sigma,
USA) followed by 4  h cultivation. Alternatively, cells
were activated by culturing for 24 h in plates with
wells pre-coated with anti-CD3 antibody OKT3 (eBio-
science, USA) at a concentration of 0.1 to 10  μg/ml. Ac-
tivation was stopped by adding cold PBS to the cells.
Immunoprecipitation. Cells were suspended in
a cold lysis buffer containing 1%  (w/v)  Triton X-100,
20  mM  Tris-HCl (pH  8.0), 150  mM  NaCl, 5  mM  EDTA,
1  mM phenylmethylsulfonyl fluoride, 10  mM  NaF, and
1  mM sodium orthovanadate (all reagents from Merck,
USA). After 30 min of incubation on ice, nuclei and in-
soluble cell membranes were removed by centrifuga-
tion for 30  min at 4°C (20,000g). Immunoprecipitation
was performed using CL7 or LT45 antibody covalently
immobilized on an AffiGel-Hz carrier (Bio-Rad, USA).
Immunoprecipitates were washed three times in a ly-
sis buffer, the protein was eluted in a sample buffer
for SDS-PAGE (62.5 mM  Tris-HCl, pH  6.8, 10%  glycerol,
2%  SDS, 1%  2-mercaptoethanol, and 0.05%  bromophe-
nol blue) by heating for 5min at 80°C.
Electrophoresis and Western blotting (WB).
Eluted proteins were separated using electrophoresis
LPAP REGULATES CD45 STABILITY 915
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
in 10 or 18% polyacrylamide gel in the presence of so-
dium dodecyl sulfate (SDS-PAGE) under reducing con-
ditions in a Laemmli buffer system. After SDS-PAGE,
proteins were transferred to a PVDF membrane using
a semi-dry method. The membrane was blocked with
5%  dry skim milk in PBS supplemented with 0.1%
Tween20. Antigens were detected using primary and
then secondary antibodies against mouse IgG labeled
with horseradish peroxidase (GE Healthcare, USA).
The signal was detected with a ChemiDoc XRS System
(Bio-Rad) using chemiluminescence reagents from
Millipore (USA).
Statistical data processing. For statistical analy-
sis and data visualization, the GraphPad Prism8 pro-
gram (GraphPad Software, USA) was used. Data were
compared using a one-sample t-test. Results are shown
as a mean  ±  standard deviation (SD). Correlation was
assessed using the nonparametric Spearman test.
RESULTS
Levels of LPAP and CD45 proteins decrease in
the absence of the partner protein. It was previously
found that in the absence of CD45 phosphatase, the lev-
el of LPAP in the cell decreases [1]. At the same time,
data on the reverse effect of LPAP on CD45 expression
are contradictory. In order to evaluate mutual influ-
ence of these two proteins, we generated the CD45 or
LPAP knockout Jurkat cell lines using the CRISPR/Cas9
technology.
It was found that in the CD45 knockout Jurkat
T  cell line, the level of LPAP was only 10% of the amount
of the protein in the parental line, which correspond-
ed to the level of autofluorescence of the wild-type
cells (Fig.1,a,b). To examine relationship between the
LPAP and CD45 expression in more detail, we gener-
ated a panel of the Jurkat LPAP
KO
sublines using two
Fig. 1. Levels of LPAP and CD45 proteins decrease in the absence of a partner protein. a)Representative cytograms of LPAP ex-
pression on the wild-type (WT) Jurkat cells, as well as on the CD45
KO
or LPAP
KO
cells. b)LPAP expression based on the results of
testing 7 CD45
KO
clones; c, d) Expression of CD45 and “irrelevant” proteins CD59 and CD98 in the Jurkat LPAP
mKO
(c) or LPAP
pKO
(d)
cultures. Protein expression levels of LPAP, CD45, CD59 and CD98 were determined using flow cytometry. Normalized CD45 ex-
pression level was compared with a reference value of 100 using a one-sample Student’s t-test(b). To compare protein levels in
the wild-type and knockout cells, ANOVA was used with posthoc analysis using Tukey’s test (c, d). ****p<0.0001.
KRUGLOVA et al.916
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
different approaches. First, we used the “tradition-
al” method of knocking out the LPAP gene using the
CRISPR/Cas9 technology, and after subsequent cloning
we obtained a series of monoclonal cultures of Jur-
kat LPAP
KO
(hereinafter referred to as LPAP
mKO
). And
next, using the recently developed SORTS method [18],
we obtained a polyclonal Jurkat population with the
knockout of LPAP (hereinafter referred to as LPAP
pKO
).
The second approach has some advantages. Firstly, the
Jurkat cell line is heterogeneous, and when working
with individual clones of this line, there is a high risk
that the observed phenotype is due to characteristics
of a particular clone, and not to the experimental im-
pact. Secondly, it has been shown that the cell clones
can be very different from both the parental popula-
tion and polyclonal population of the sorted knockout
cells due to consolidation of the off-target genomic
changes [17-19].
In all Jurkat LPAP
mKO
cultures, the CD45 expres-
sion was reduced to 30% of the wild-type level (Fig.1c).
The CD45 level in the Jurkat LPAP
pKO
cells was 37% of
the CD45 level in the wild-type cells (Fig. 1d). Agree-
ment between the data obtained for the individual
clones and for the polyclonal population allows us to
exclude contribution of interclonal variability to the
observed phenotype. As a control, we used the CD59
and CD98 molecules as “irrelevant” proteins, for which
there is no data on their interaction with LPAP. The level
of “irrelevant” proteins CD59 and CD98 also decreased,
but to a significantly lesser extent than CD45 (Fig.  1c;
p  <  0.0001). This indicates specific nature of the decrease
in the CD45 protein level in the LPAP knockout cells.
CD45 expression correlates with the level of
LPAP. After we discovered that the LPAP knockout
resulted in the decrease in the CD45 protein level, we
decided to investigate whether restoration of the level
of LPAP in the cells could increase the phosphatase ex-
pression. For this purpose, we selected one of the Jur-
kat LPAP
mKO
clones and introduced the gene encoding
LPAP
wt
into it using stable lentiviral transduction. The
resulting population was then cloned and the effect of
restoration of the expression of LPAP and CD45 pro-
teins was assessed using flow cytometry. When testing
21 Jurkat subclones, we found high level of correlation
between the CD45 and LPAP expression (Spearman
correlation coefficient r  =  0.77, p  <  0.0001) (Fig.  2a).
In contrast, for the clones tested, there was no signif-
icant correlation between the LPAP expression and
expression of the irrelevant protein CD98 (r  = 0.02)
(Fig.2b). As an additional control, we used the Jurkat
WT clones, in which there was also no correlation be-
tween the levels of LPAP and CD45 (Fig.  2c). This con-
trol shows that the correlation shown in Fig.2a is not
the result of a cloning procedure.
Since the described result was shown in the cells
derived from a single Jurkat LPAP
KO
clone and could
be due to characteristics of the randomly selected clone,
we decided to verify the results with the data obtained
from a polyclonal knockout. For this purpose, the gene
encoding LPAP
wt
, or the GFP gene in the control sam-
ple, was introduced into the Jurkat LPAP
pKO
cells by
lentiviral transduction. During transduction, three in-
creasing doses of the virus were used (#1, #2, #3), after
which expression of LPAP and CD45 in the resulting
cultures was analyzed using flow cytometry. With in-
crease of the LPAP level (Fig.2d), the amount of CD45
in the cells also increased (Fig.  2,  e,  f). Difference be-
tween the levels of surface and total CD45 observed
in the pKO cells did not change upon re-expression
of LPAP (Fig.  2e). This indicates that in the absence
of LPAP, CD45 is degraded and is not retained and ac-
cumulated in the vesicular system of the cell.
In the cells with enhanced LPAP expression
the CD45 level increases. In the previous step, we
found correlation between the LPAP and CD45 levels
in the Jurkat cells with the LPAP levels ranging from
0% to 100% and CD45 levels ranging from 30% to
100%, relative to their endogenous expression levels.
However, the question arises whether this correla-
tion would persist with further increase in the level
of LPAP in the cells. Using lentiviral transduction, a
construct containing the LPAP-Flag-IRES-GFP cassette
was introduced into the Jurkat cells. After two rounds
of GFP
hi
cell sorting, the level of LPAP increased mark-
edly (Fig.  3a). In order to distinguish between the
endogenous LPAP and exogenous LPAP-Flag, electro-
phoresis was performed in the 18% PAAG. Increase
in the intensity of the band with the increased mo-
lecular weight was observed, which corresponded to
the LPAP protein with the Flag peptide tag, compared
with the intensity of the endogenous LPAP bands
(Fig.3b).
We hypothesized that in the Jurkat lymphoid cells
there is a special mechanism for homeostatic regula-
tion of LPAP levels, which cannot be bypassed by len-
tiviral transduction. Then we took the K562 cells of the
erythromyeloid lineage, which carry CD45 on the sur-
face, but are practically devoid of the endogenous LPAP
(MFI  =  3000). After lentiviral transduction, the K562
cells expressed high levels of LPAP-Flag (MFI  =  116,000)
(Fig.  3c). At the same time, the CD45 protein level also
increased 3.1-fold (Fig.  3d). Thus, both the increased
LPAP expression and its ectopic expression led to the
increased CD45 expression.
LPAP knockout reduces CD3-induced expres-
sion of the activation molecule CD69. One of the ear-
ly manifestations of T cell activation is upregulation of
the CD69 protein exposure on the plasma membrane.
In order to evaluate possible contribution of LPAP to
intracellular signal transduction, we compared expres-
sion of the CD69 molecule on the Jurkat WT and Jurkat
LPAP
pKO
cells upon activation with PMA or antibodies
LPAP REGULATES CD45 STABILITY 917
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 2. CD45 levels correlate with LPAP protein levels. a,b)Correlation between the levels of LPAP and CD45(a) or LPAP and
CD98(b) in the Jurkat LPAP
KO
clones with LPAP
WT
re-expression. c)Correlation between LPAP and CD45 levels in the Jurkat
LPAP
WT
clones; d,e) LPAP (d) and CD45 (e) levels in the Jurkat LPAP
pKO
cells stably transduced with the increasing doses of
virus to re-express LPAP
wt
(#1, #2, #3) or express GFP. LPAP expression is normalized to the expression in the Jurkat LPAP
wt
cells. ForCD45, values are shown for the surface (sCD45) and total (tCD45) levels. f)Correlation between LPAP and CD45 levels
in the Jurkat LPAP
KO
clones stably transfected with LPAP
wt
. Expression levels were determined from MFI values, which were
normalized to the Jurkat WT mean expression after subtracting the background level in the Jurkat CD45
KO
or Jurkat LPAP
KO
cells. Individual values as well as mean values ±SD are shown. Normalized expression level of LPAP in the transduced cells
was compared with the value of zero in the GFP-expressing cells using a one-sample Student’s t-test(d). ANOVA with posthoc
analysis using Tukey’s test was used to compare surface(s) and total(t) CD45 levels in the Jurkat LPAP
pKO
cells and transducers.
***p<0.001, ****p<0.0001. Mean values for LPAP and sCD45 levels from(e) were used to calculate the correlation(f).
against the CD3 receptor. When stimulated with PMA,
the pKO cells expressed 40% less CD69 molecules than
the wild-type cells (Fig.4a). We then used a more phys-
iological stimulus, CD3 cross-linking using the OKT3
antibody. Since the CD69 expression on the OKT3-ac-
tivated Jurkat cells has a bimodal distribution (Fig.4b,
left panel), we compared the LPAP knockout cells and
the wild-type cells by two parameters: percentage of
the activated cells and MFI of the CD69
+
cells from the
population with high level of CD69 (gating to the corre-
sponding populations is shown in Fig.4b, middle and
right panels).
KRUGLOVA et al.918
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 3. In the cells with enhanced expression of LPAP, the level of CD45 increases. a,b)Level of LPAP protein was analyzed in
the Jurkat and Jurkat LPAP-Flag cell lines after the first and second sorting (sort1 and sort2). Cells were lysed, LPAP or CD45
proteins were isolated by immunoprecipitation (IP), samples were separated by electrophoresis on a 12%(a) or 18%(b) gel, and
Western blotting was performed with the indicated antibodies. The lower blot(b) was stained with antibodies against Flag and
LPAP. The LPAP and LPAP-Flag bands are indicated by arrows. c,d)Expression of LPAP and CD45 on the surface of wild-type
K562 cells, as well as of the cells stably transduced with LPAP-Flag.
Jurkat cells are characterized by low level of CD3
expression, which is detected only on some cells. Wehy-
pothesize that these CD3
+
cells respond to stimulation
with the OKT3 antibody, resulting in the bimodal dis-
tribution of CD69. When activated via CD3, a significant
difference between the Jurkat WT and LPAP
pKO
cells
was observed in the samples with high concentration of
OKT3 (1 and 10  μg/ml). Moreover, in the case of the pKO
population, almost all cells were activated, but the lev-
el of CD69 on them was reduced compared to the wild-
type cells (Fig.  4b, left panel). This difference could be
due to the different levels of CD3 on the two cell types
(Fig.  4c, left panel). In the pKO population, percentage of
the CD3
+
-positive cells was higher (Fig.  4c, middle pan-
el), while MFI of the CD3
+
-positive population was low-
er compared to the wild-type cells (Fig.  4c, right panel),
which is consistent with the result for CD69 expression.
DISCUSSION
Role of the LPAP protein in the cell remains un-
known, but formation of a tight complex with CD45 in-
dicates that the LPAP function may be associated with
regulation of this phosphatase. Changes in the phos-
phorylation status of LPAP upon T cell activation sug-
gest that LPAP is a participant of the Tcell lymphocyte
receptor signaling cascade [5].
Some studies suggest that the CD45 phosphatase is
required to maintain LPAP stability [7,  13]. This is in
good agreement with our data that in the CD45 knock-
out Jurkat cells, the level of LPAP decreases by 90%.
We previously showed that the knockdown of CD45
using shRNA reduced LPAP expression by more than
twofold [8]. Finally, the Jurkat-derived cell line J45.01,
which has only 5-8% of CD45 [20], expresses three
LPAP REGULATES CD45 STABILITY 919
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 4. Comparison of CD69 and CD3 expression on the wild-type and LPAP knockout Jurkat cells. a)CD69 expression on the
cells activated with PMA. b)Expression of CD69 on the cells activated with the OKT3 antibody. c)CD3 expression on the cells ac-
tivated with the OKT3 antibody. Levels of CD69(b) and CD3(c) were compared using a two-sample t-test. *p<0.05, **p<0.01,
****p<0.0001.
times less LPAP than the wild type [8]. Thus, there is
consistent evidence that when the CD45 level decreas-
es, the amount of LPAP in the cell decreases signifi-
cantly.
To answer the question about the possible effect
of LPAP on the CD45 protein levels, we generated a
panel of LPAP knockout Jurkat sublines. It was found
that in the knockout population, the level of CD45 was
reduced to 30% of the wild-type levels. This is the most
pronounced effect of all those described in the litera-
ture [9-11]. It could be suggested that LPAP affect not
stability of the CD45 phosphatase, but rather its local-
ization. However, our data on the effect of LPAP on to-
tal and surface CD45 levels (Fig.  2,  e,  f) do not support
this assumption. We further showed that when LPAP
expression was restored, the CD45 level increased, and
there was a correlation between the levels of these
proteins. Using lentiviral transduction of Jurkat cells,
KRUGLOVA et al.920
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
we were unable to achieve a significant increase in
the LPAP levels compared to the wild-type cells. On
the other hand, cells of the erythromyeloid line K562,
which do not carry endogenous LPAP, were capable of
stable overexpression of this protein. We hypothesize
that there is a tight mechanism in the lymphoid cells
that controls the level of LPAP and this mechanism is
absent in the nonlymphoid cells. It should be noted
that the CD45RB isoform is predominantly present on
the Jurkat cells, and the CD45R0 isoform is predomi-
nantly present on the K562 cells. We have previously
shown that LPAP is associated with all isoforms ap-
proximately equally [8], therefore, different behavior
of LPAP on the Jurkat and K562 cells cannot be ex-
plained by association with different CD45 isoforms.
The data we obtained previously, as well as the
results presented in this work, indicate that the CD45
phosphatase maintains stability of LPAP and influenc-
es its phosphorylation status, and the LPAP protein, in
turn, is able to regulate the level of CD45. Stability of
the CD45 protein is probably not entirely determined
by the LPAP molecule. This leads to the fact that even
with the complete knockout of LPAP, at least 30% of the
CD45 protein level is detected in the wild-type cells. In-
direct evidence suggests that LPAP may influence the
strength of T cell responses to low-affinity ligands [21]
and may also be involved in the regulation of B cell
differentiation [3]. It could be assumed that all this oc-
curs indirectly, through the regulation of CD45 levels.
The group of Schraven et al. (1991) showed that
without CD45, LPAP is synthesized, but is quickly de-
graded [7]. It could be assumed that the opposite is true
regarding the CD45 stability. It is possible that in the
absence of a partner protein, the regions responsible
for recognition by the degradation system are exposed
in the CD45 and LPAP proteins. The balance of activ-
ity of ubiquitin ligases and deubiquitinating proteins
is important for regulation of the signaling pathways,
including the T cell receptor cascade [22]. For example,
ubiquitination of the TCR chains by CBL-b is required
for receptor degradation and attenuation of the signal-
ing cascade during the late stages of T cell activation.
Another example of a protein whose main function is
to bind and maintain partner stability is the transmem-
brane polypeptide type 6 (CMTM6), which interacts
with the programmable cell death receptor ligand [23].
Bioinformatics analysis predicts that most of the
cytoplasmic region of LPAP does not have a pronounced
structure [24], and, hence, LPAP can be classified as
an intrinsically disordered protein (IDP). Such pro-
teins can acquire a certain conformation when inter-
acting with a partner molecule [25]. The intrinsically
disordered proteins, due to their ability to interact
with various partners, often act as adapter proteins or
scaffold proteins for the assembly of multicomponent
complexes. They can interact with high specificity and
moderate affinity, which is necessary for the strictly
time-regulated processes and makes them important
participants in signaling cascades [26]. It is possible
that LPAP mediates interactions of CD45 with other
proteins.
The question of LPAP contribution to activation
of the signaling cascade of T lymphocytes still remains
open. In our work, the LPAP knockout Jurkat popula-
tions expressed fewer CD69 molecules, when activated
with PMA or OKT3. Based on these data, direct effect
of LPAP on the signaling cascade could be suggested,
however, such interpretation is complicated by the
possible indirect effect of LPAP through regulation of
the CD45 expression. An indication of the possible in-
volvement of LPAP in T lymphocyte activation is ob-
servation that the reduced LPAP expression on the tu-
mor-infiltrating lymphocytes is a potential marker of
triple-negative breast cancer [27].
CONCLUSION
Our data suggest that the main function of LPAP
is to modulate the level of CD45 protein. This raises a
number of questions for further research. How does
the interaction of these two proteins maintain their
stability and what is the mechanism of degradation of
CD45 and LPAP in the absence of a partner protein?
Why is CD45 protein stable in the myeloid cells that
do not constitutively express LPAP? Is there a specific
mechanism of CD45 regulation in the lymphoid cells
associated with LPAP? Answers to these questions will
help reveal new details of lymphocyte activation.
Acknowledgments. The work used equipment
provided by the Center for High-Precision Genome Ed-
iting and Genetic Technologies for Biomedicine (Insti-
tute of Gene Biology) organized with the support of the
Ministry of Science and Higher Education of the Rus-
sian Federation.
Contributions. N.A.K., D.V.M., and A.V.F. concept
of work; N.A.K. performing experiments; N.A.K., D.V.M.,
and A.V.F. discussion of the research results; N.A.K. text
writing; D.V.M. and A.V. F. editing the text of the article.
Funding. This work was financially supported by
the Russian Science Foundation (project no.23-15-00289).
Ethics declarations. This work does not contain
any studies involving human and animal subjects.
Theauthors of this work declare that they have nocon-
flicts of interest.
REFERENCES
1. Schraven,B., Schoenhaut,D., Bruyns,E., Koretzky,G.,
Eckerskorn, C., et al. (1994) LPAP, a novel 32-kDa
LPAP REGULATES CD45 STABILITY 921
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
phosphoprotein that interacts with CD45 in human
lymphocytes, J.Biol. Chem., 269, 29102-29111.
2. Rheinländer, A., Schraven, B., and Bommhardt, U.
(2018) CD45 in human physiology and clinical medi-
cine, Immunol. Lett., 196, 22-32, doi: 10.1016/j.imlet.
2018.01.009.
3. Kleiman,E., Salyakina,D., De Heusch,M., Hoek, K.L.,
Llanes, J.M., etal. (2015) Distinct transcriptomic fea-
tures are associated with transitional and mature
B-cell populations in the mouse spleen, Front. Immu-
nol., 6, 30, doi:10.3389/fimmu.2015.00030.
4. Kruglova, N. A., Meshkova, T. D., Kopylov, A. T., Ma-
zurov, D.V., and Filatov, A.V. (2017) Constitutive and
activation-dependent phosphorylation of lympho-
cyte phosphatase-associated phosphoprotein (LPAP),
PLoS One, 12, e0182468, doi: 10.1371/journal.pone.
0182468.
5. Kruglova, N., and Filatov, A. (2019) T cell receptor
signaling results in ERK-dependent Ser163 phos-
phorylation of lymphocyte phosphatase-associated
phosphoprotein, Biochem. Biophys. Res. Commun., 519,
559-565, doi:10.1016/j.bbrc.2019.09.041.
6. Takeda, A., Matsuda, A., Paul, R. M. J., and Yaseen,
N.R. (2004) CD45-associated protein inhibits CD45 di-
merization and up-regulates its protein tyrosine phos-
phatase activity, Blood, 103, 3440-3447, doi: 10.1182/
blood-2003-06-2083.
7. Schraven,B., Kirchgessner,H., Gaber,B., Samstag,Y.,
and Meuer, S.A. (1991) functional complex is formed
in human T lymphocytes between the protein ty-
rosine phosphatase CD45, the protein tyrosine ki-
nase p56lck and pp32, a possible common substrate,
Eur. J. Immunol., 21, 2469-2477, doi: 10.1002/eji.
1830211025.
8. Filatov, A., Kruglova, N., Meshkova, T., and Ma-
zurov, D. (2015) Lymphocyte phosphatase-associ-
ated phosphoprotein proteoforms analyzed using
monoclonal antibodies, Clin. Transl. Immunol., 4, e44,
doi:10.1038/cti.2015.22.
9. Ding, I., Bruyns, E., Li, P., Magada, D., Paskind, M.,
et al. (1999) Biochemical and functional analysis of
mice deficient in expression of the CD45-associated
phosphoprotein LPAP, Eur.J. Immunol., 29, 3956-3961,
doi: 10.1002/(SICI)1521-4141(199912)29:12<3956::AID-
IMMU3956>3.0.CO;2-G.
10. Matsuda,A., Motoya, S., Kimura,S., McInnis, R., Mai-
zel, A.L., etal. (1998) Disruption of lymphocyte func-
tion and signaling in CD45-associated protein-null
mice, J. Exp. Med., 187, 1863-1870, doi: 10.1084/
jem.187.11.1863.
11. Kung,C., Okumura,M., Seavitt, J.R., Noll, M.E., White,
L.S., etal. (1999) CD45-associated protein is not essen-
tial for the regulation of antigen receptor-mediated
signal transduction, Eur. J. Immunol., 29, 3951-3955,
doi: 10.1002/(SICI)1521-4141(199912)29:12<3951::AID-
IMMU3951>3.0.CO;2-9.
12. Bruyns,E., Kirchgessner,H., Meuer,S., and Schraven,B.
(1998) Biochemical analysis of the CD45-p56(Lck) com-
plex in Jurkat T cells lacking expression of lymphocyte
phosphatase-associated phosphoprotein, Int. Immu-
nol., 10, 185-194, doi:10.1093/intimm/10.2.185.
13. Kitamura,K., Matsuda,A., Motoya,S., and Takeda,A.
(1997) CD45-associated protein is a lymphocyte-spe-
cific membrane protein expressed in two distinct
forms, Eur. J. Immunol., 27, 383-388, doi: 10.1002/
eji.1830270207.
14. Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Koner-
mann, S., Agarwala, V., et al. (2013) DNA targeting
specificity of RNA-guided Cas9 nucleases, Nat. Biotech-
nol., 31, 827-832, doi:10.1038/nbt.2647.
15. Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M.,
et al. (2013) RNA-guided human genome engineer-
ing via Cas9, Science, 339, 823-826, doi: 10.1126/
science.1232033.
16. Ran, F.A., Hsu, P.D., Lin, C.-Y., Gootenberg, J.S., Koner-
mann,S., etal. (2013) Double nicking by RNA-guided
CRISPR Cas9 for enhanced genome editing specificity,
Cell, 154, 1380-1389, doi:10.1016/j.cell.2013.08.021.
17. Zotova,A., Pichugin,A., Atemasova,A., Knyazhanska-
ya, E., Lopatukhina, E., et al. (2019) Isolation of
gene-edited cells via knock-in of short glycophospha-
tidylinositol-anchored epitope tags, Sci. Rep., 9, 3132,
doi:10.1038/s41598-019-40219-z.
18. Mazurov, D. V. (2020) Gene and Genome Editing Meth-
ods (Zakiyan, S. M., Medvedev, S. P., Dementieva, E. V.,
Vlasov, V. V., eds) SB RAS, Novosibirsk, pp.413-444.
19. Zotova, A., Lopatukhina, E., Filatov, A., Khaitov, M.,
and Mazurov, D. (2017) Gene editing in human lym-
phoid cells: role for donor DNA, type of genomic
nuclease and cell selection method, Viruses, 9, 325,
doi:10.3390/v9110325.
20. Koretzky, G. A., Picus, J., Schultz, T., and Weiss, A.
(1991) Tyrosine phosphatase CD45 is required for
T-cell antigen receptor and CD2-mediated activa-
tion of a protein tyrosine kinase and interleukin 2
production, Proc. Natl. Acad. Sci. USA, 88, 2037-2041,
doi:10.1073/pnas.88.6.2037.
21. Leitenberg, D., Falahati, R., Lu, D. D., and Takeda, A.
(2007) CD45-associated protein promotes the response
of primary CD4 T cells to low-potency T-cell receptor
(TCR) stimulation and facilitates CD45 association
with CD3/TCR and Lck, Immunology, 121, 545-554,
doi:10.1111/j.1365-2567.2007.02602.x.
22. Gaud,G., Lesourne,R., and Love, P.E. (2018) Regulato-
ry mechanisms in T cell receptor signalling, Nat. Rev.
Immunol., 18, 485-497, doi:10.1038/s41577-018-0020-8.
23. Burr, M.L., Sparbier, C.E., Chan, Y.-C., Williamson, J.C.,
Woods,K., etal. (2017) CMTM6 maintains the expres-
sion of PD-L1 and regulates anti-tumour immunity,
Nature, 549, 101-105, doi:10.1038/nature23643.
24. Oates, M.E., Romero,P., Ishida,T., Ghalwash,M., Miz-
ianty, M.J., etal. (2012) D2P2: database of disordered
KRUGLOVA et al.922
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
protein predictions, Nucleic Acids Res., 41, D508-D516,
doi:10.1093/nar/gks1226.
25. Uversky, V.N. (2019) Intrinsically disordered proteins
and their “mysterious” (meta)physics, Front. Phys., 7,
10, doi:10.3389/fphy.2019.00010.
26. Wright, P.E., and Dyson, H.J. (2015) Intrinsically dis-
ordered proteins in cellular signalling and regula-
tion, Nat. Rev. Mol. Cell Biol., 16, 18-29, doi: 10.1038/
nrm3920.
27. Marchetti, P., Antonov, A., Anemona, L., Vangapan-
dou,C., Montanaro,M., etal. (2021) New immunolog-
ical potential markers for triple negative breast can-
cer: IL18R1, CD53, TRIM, Jaw1, LTB, PTPRCAP, Discov.
Oncol., 12, 6, doi:10.1007/s12672-021-00401-0.
Publisher’s Note. Pleiades Publishing remains
neutral with regard to jurisdictional claims in pub-
lished maps and institutional affiliations.