ISSN 0006-2979, Biochemistry (Moscow), 2024, Vol. 89, No. 5, pp. 933-941 © Pleiades Publishing, Ltd., 2024.
933
Extending Linker Sequences between Antigen-
Recognition Modules Provides More Effective Production
of Bispecific Nanoantibodies in the Periplasma of E.coli
Sergei V. Tillib
1,2,a
* and Oksana S. Goryainova
1,2
1
Institute of Gene Biology, Russian Academy of Sciences, 119334 Moscow, Russia
2
Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, 119991 Moscow, Russia
a
e-mail: tillib@genebiology.ru
Received December 21, 2023
Revised April 27, 2024
Accepted April 27, 2024
Abstract— Technology of production of single-domain antibodies (NANOBODY® molecules, also referred to as
nanoantibodies, nAb, or molecules based on other stable protein structures) and their derivatives to solve cur-
rent problems in biomedicine is becoming increasingly popular. Indeed, the format of one small, highly soluble
protein with a stable structure, fully functional in terms of specific recognition, is very convenient as a module
for creating multivalent, bi-/oligo-specific genetically engineered targeting molecules and structures. Production
of nAb in periplasm of E.coli bacterium is a very convenient and fairly universal way to obtain analytical quan-
tities of nAb for the initial study of the properties of these molecules and selection of the most promising nAb
variants. The situation is more complicated with production of bi- and multivalent derivatives of the initially
selected nAbs under the same conditions. In this work, extended linker sequences (52 and 86aa) between the
antigen-recognition modules in the cloned expression constructs were developed and applied in order to increase
efficiency of production of bispecific nanoantibodies (bsNB) in the periplasm of E.coli bacteria. Three variants
of model bsNBs described in this study were produced in the periplasm of bacteria and isolated in soluble form
with preservation of functionality of all the protein domains. If earlier our attempts to produce bsNB in the peri-
plasm with traditional linkers no longer than 30aa were unsuccessful, the extended linkers used here provided a
significantly more efficient production of bsNB, comparable in efficiency to the traditional production of original
monomericnAbs. The use of sufficiently long linkers could presumably be useful for increasing efficiency of pro-
duction ofother bsNBs and similar molecules in the periplasm of E.coli bacteria.
DOI: 10.1134/S0006297924050134
Keywords: single domain antibody, nanoantibody, bispecific antibody, multimodule antibody
Abbreviations: bsNB,bispecific nanoantibody; ILZ,trimerizing domain; nAb,nanoantibody; PBS,phosphate-buffered saline.
* To whom correspondence should be addressed.
INTRODUCTION
New drugs and tools based on monoclonal anti-
bodies and their derivatives have revolutionized bio-
medicine and immunobiotechnology. In recent years,
in addition to classical monoclonal antibodies, en-
gineering of the recombinant antibody fragments as
well as other antigen-binding molecules has received
increasing attention from many researchers. Today,
one of the most promising technologies for creation
of the targeting genetically engineered molecules and
structures that are multivalent and bi-/oligo-specific
is production of the recombinant derivatives of sin-
gle-domain antigen-binding fragments (VHH) of spe-
cial antibodies (HCAb, heavy-chain only antibodies),
which comprise a homodimer of the shortened heavy
chain with complete absence of light chains. Such spe-
cial antibodies are present normally in the blood of
members of the Camelidae family and in some carti-
laginous fish species in addition to the classical types
of immunoglobulins [1, 2]. Camelids naturally produce
antibodies in which the target recognition module
TILLIB, GORYAINOVA934
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
consists of a single variable domain (VHH), recombi-
nant version of which is also referred to as a single-
domain antibody, nanoantibody(nAb) or NANOBODY®
molecule (NANOBODY® and NANOBODIES® are regis-
tered trademarks of Ablynx N.V., a subsidiary of Sanofi,
so we will not use these names further in the article).
The main features of nAbs are their small size (10-fold
smaller than a classical antibody), high solubility, sta-
bility (in a wide range of temperatures and pH), abili-
ty to recognize unusual epitopes hidden for classical
antibodies, possibility of using a very effective phage
display method for selection of optimal nAb variants,
as well as ease of their various modifications by genet-
ic engineering methods. Nanoantibodies could be cou-
pled to Fc-domains, other nAbs, peptide tags or toxins
and could be chemically conjugated with drugs, ra-
dionuclides, photosensitizers, and nanoparticles [3-5].
Efficient methods of genetically engineered modifica-
tion (formatting) of the initially selected monovalent
nAbs have been developed in order to adapt them for
specific use. More complex derivative molecules, mul-
tivalent, bispecific, and other constructs created on
their basis could exhibit significantly higher specificity
and binding efficiency, as well as significantly higher
biological activity. On the basis of formatted nAbs, new
biological tools and materials with improved proper-
ties could be developed, for example, to fight viral or
other infections [6-10]. Despite the numerous exam-
ples of designing and application of bispecific nAbs
[11-14], including using bacterial expression systems
[15-17], currently there is no universal enough meth-
od for their rapid production in soluble and functional
form for preliminary testing and selection of the most
promising variants. Researchers pay attention to the
methods of protein synthesis induction, suitable cell
strains, and specific plasmid vectors. In the most re-
cent studies [11, 13] and reviews [15-17] bispecific
nAbs (bsNBs) were isolated from the bacterial cell
lysate, but under such conditions bsNBs could dena-
ture and form undesirable bonds with other proteins
present in the sample. At the same time, very few
approaches to obtain bispecific nAbs with sufficient-
ly good yield under conditions close to physiological
ones have been described. One of the effective options
may be isolation of such nAbs from the bacterial peri-
plasm, where, unlike in the cytosol, cysteine bonds
that stabilize immunoglobulin structure are properly
formed[18].
Design of expression constructs with two or more
such domains requires particular attention to the
linker sequences (linkers) between the variable anti-
gen-recognizing antibody domains. It has been shown
that both length and composition of the linkers could
influence the production efficiency, stability, and bi-
ological activity of both genetically engineered sin-
gle-chain antibody [19,  20] and bispecific nAb [21].
The most detailed information on the development
of linkers between the antigen-recognizing modules
in the course of creation of bispecific nAbs is given in
an extensive patent on this topic [22] from the world’s
main developer of nAb technology and biomedical
products based on it – the Belgian company ABLYNX
NV, which recently became part of the global phar-
maceutical company Sanofi. The authors of the patent
provide the list of a large number of linkers with refer-
ences that have been described and used up to the end
of 2014. In the patent, lengths of the reported linkers
range from 1 to 50 amino acid residues (aa).
It should be noted that production of bi- and mul-
tivalent nAb derivatives in bacterial periplasm is often
a difficult task. In particular, our laboratory has accu-
mulated considerable experience in the production of
a variety of monovalent nAbs in bacterial periplasm,
but our initial experiments on design and production
of bispecific and multivalent nAbs in bacterial peri-
plasm revealed that the procedure using for this pur-
pose the currently most popular method of cloning
two copies of VHH separated by a traditional linker
sequence such as (GGGGS)
3
or a 28  aa linker created
on the basis of the hinge region of the non-canonical
Camel antibody was unreliable (instability of the con-
structs, high mutability, very low efficiency of produc-
tion and isolation of soluble nAbs) [8]. The aim of this
study was to test the assumption that it is possible to
increase efficiency of bispecific nAb production by
significant increase of the linker length using combi-
nation of the shorter linker sequences that we have
previously used. The main objectives of this work
were: (i)  to create new constructs for expression of
bsNBs with two variants of elongated linkers based on
the previously cloned sequences of monovalent nAbs;
(ii)  to use the obtained constructs to test efficiency of
the bsNBs production in bacterial periplasm and their
isolation in soluble form, (iii)to analyze functionality
of the antigen-binding modules of isolated bsNBs.
MATERIALS AND METHODS
Molecular cloning of expression constructs for
production of bispecific nAbs in E.  coli periplasm.
Cloning of the constructs schematically shown in Fig.1
(see the Results and Discussion section) based on the
previously obtained nAb variants [8, 23-25], which al-
ready contain the left N-terminal part of the indicat-
ed linkers at the end of the formatted nAb sequence
(the hinge region of 28  aa is grayed out in Fig.  1; the
hinge region is additionally followed by trimerizing
domain (ILZ) in some taken clones) into the phagemid
vector pHEN6 was performed using competent E.  coli
XL-1 Blue cells (Eurogen, Russia), [26], which contain
the gene of resistance to ampicillin. PCR cloning was
BISPECIFIC NANOANTIBODIES 935
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Primers for PCR cloning
Primer Sequence (5′-3′)
NcoI-VHH-fd CGAGCCGACCATGGCCCTGCAGGTGCAGCTGGTGGAGTCTGG
BamHI-rev (for linker 1) ACCTGGATCCCTCGAGCCGCTTTCTGGTTCAGG
BamHI-rev (for linker 2) ACCTGGATCCCTCGAGCCGCTACGTTCACCCAC
BamHI-fd CGAGGGATCCAGGTGGAGGCGGTTCAGGCGGAGGTGGCA
Sal-rev ATGTCCGTCGACTCTAGACCGCCACCGCCGCTGCCACCT
SalI-fd GCGGTCGACGGCTCAGGTGCAGCTGGTGGAGT
NotI-rev GGACTAGTGCGGCCGCTTGAGGAGACGGTGACCTGGGT
NotI-fd GCGAGCGGCCGCTACCCGTACGAC
EcoRI-rev GCGGAATTCTATTAGCCGGAAGCGTAGTC
performed in several steps using pairs of synthesized
oligonucleotides (table), restriction and ligation re-
actions similar to those described previously [8]. The
final bispecific constructs were incorporated into the
pHEN6 phagemid vector at the NcoI and EcoRI sites.
These constructs consist of four principle fragments
(Fig.  1): NcoI to BamHI (VHH1 and N-terminus of
the linker), BamHI to SalI (C-terminus of the linker,
PGGGGSGGGGSGGGGLE), SalI to NotI (VHH2), and NotI
to EcoRI (HA-tag, His-tag). These fragments were ob-
tained by restriction of PCR products synthesized with
the following primer pairs: NcoI-VHH-fd and Bam-
HI-rev (previously obtained nAb clones were used as
a template); BamHI-fd and SalI-rev (without DNA tem-
plate); SalI-fd and NotI-rev (nAb clones); NotI-fd and
EcoRI-rev (nAb clones). Correctness of the intermedi-
ate constructs was confirmed by PCR and by checking
length of the resulting products; sequences of the final
constructs were verified by sequencing after cloning
was completed. Full information on the sequences of
the obtained constructs can be found in our patent ap-
plication [27].
Production and purification of bispecific nAbs.
Expression of nanoantibodies and preparation of peri-
plasmic extract were performed according to the pre-
viously described protocol [28] with minor modifica-
tions. Overnight bacterial culture of E.  coli XL1 Blue
containing plasmid DNA with the expression construct
was obtained from a freshly grown single colony on a
LB-agar supplemented with 1% glucose and 100  μg/ml
ampicillin by incubation in 5 ml of LB medium with
0.2% glucose and 70  μg/ml ampicillin overnight on an
Excella C24R Shaker Incubator (New Brunswick Sci-
entific, USA) at 180 rpm and 37°C. Overnight culture
was diluted 50-100-fold in 300  ml of 2xYT medium con-
taining 0.2% glucose. The bacteria were cultured for
30  min at 180  rpm and 37°C, after which ampicillin
was added to concentration 70 μg/ml and incubation
was continued. When the bacterial culture reached
an optical density of 0.6 at a wavelength of 600  nm,
0.5  mM isopropyl-beta-D-galactopyranoside (IPTG)
solution was added, incubation temperature was low-
ered to 28-30°C, and the cells were incubated for 5  h.
The cells were isolated by centrifugation for 10min at
3000g. Next, osmotic shock procedure was performed
to isolate the periplasmic extract. The cell precipitate
was suspended in a sucrose-containing buffer (50  mM
Tris-HCl, pH  8.0, 0.5  mM EDTA, 20% sucrose, 10  mM im-
idazole, freshly added 1  mM PMSF) and incubated in
an ice bath for 30  min. Aqueous buffered saline solu-
tion (10  mM  Tris-HCl, pH  8.0, 1  mM  MgCl
2
) was then
added, mixed thoroughly and rapidly, and the cell sus-
pension was left on ice for another 30  min, after which
the cells were centrifuged for 20  min at 16,000g. The
supernatant containing periplasmic extract was taken
and NaCl was added to a final concentration of 0.3 M.
In the case of isolating a periplasmic extract contain-
ing trimerizing bispecific nAbs, it was important to use
additional modifications of the procedure, including
disruption of the cell wall by adding 5 mg/ml lysozyme
to the solution containing sucrose and adding 20  mM
imidazole to the subsequent aqueous solution.
The target protein was purified by metal-chelate
affinity chromatography on a Ni
2+
-NTA-agarose using
a HIS-Select Nickel Affinity Gel (Sigma-Aldrich, USA).
This purification is possible due to the presence of six
histidine residues (His-tag) at the C-terminus of for-
matted nAb. Purification was performed according to
the manufacturer’s protocol. The column volume was
selected according to the volume of the initial culture
TILLIB, GORYAINOVA936
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
and periplasmic extract obtained; on average, a 0.5  ml
column was used to purify nAb extracted from 300 ml
of culture. The column was equilibrated with a “lysis”
buffer (50  mM  NaH
2
PO
4
pH  8.0, 0.3  M  NaCl, 10  mM im-
idazole). When purifying presumably trimerizing bispe-
cific antibodies, the amount of imidazole in the buffer
was increased to 20  mM. Periplasmic extract was add-
ed to the column and protein sorption was performed
by “batch”-method, mixing the extract and agarose on
a Bio RS-24 mini-rotator (Biosan, Latvia) for 30-40  min.
Next, the column was placed in a vertical position,
Ni
2+
-NTA-agarose was allowed to settle, and the extract
was passed through it. The column was then washed
in three steps using a lysis buffer with a total volume
equal to 10 column volumes. Protein elution was per-
formed fractionally by adding one column volume
of elution buffer (50  mM  NaH
2
PO
4
pH  8.0, 0.3  M  NaCl,
250 mM imidazole) three times. Thus, an eluate vol-
ume of 1.5ml was obtained from one 0.5ml column.
Protein electrophoresis. Quality and quantity of
nAb contained in the obtained eluate were determined
by analyzing aliquots of purified nAb with electropho-
resis in a 5-19% gradient SDS-polyacrylamide gel (SDS-
PAGE) performed according to the method of Laemmli
[29] under reducing conditions. A MiniProtean  II elec-
trophoresis cell (Bio-Rad, USA) was used with a power
source Elf-4 (DNA-Technology, Russia). DTT (dithioth-
reitol) was used as a reducing agent. Before sample
application, a buffer (31.25  mM  Tris-HCl pH  6.8; 12.5%
glycerol; 1%  SDS; 0.005%  bromophenol blue) was add-
ed to the samples, and the samples were heated for
10  min at 97°C. Electrophoresis was performed in a
standard SDS buffer (0.2  M glycine, 0.025  M  Tris, 0.1%
SDS). A Precision Plus Protein Standards protein set
(161-0363, Bio-Rad) was used as molecular weight
markers. Approximate amount of nAb in the corre-
sponding band on the stained gel was estimated rel-
ative to the intensity of the marker bands (for exam-
ple, in 5  μl of the marker set, intensity of the 50-kDa
band corresponds to approximately 375  ng and of the
20-kDa band corresponds to 75  ng of protein).
Enzyme-linked immunosorbent assay (ELISA)
to test functionality of both nAb modules in compo-
sition of the resulting dual-module bispecific nAb.
The following antigens were used: recombinant human
ICAM-1 (R&D Systems, USA), recombinant birch pollen
allergen Bet v  1 (Biomay AG, Austria), recombinant
hemagglutinin (HA-H5) of influenza virus H5N2 (Sino
Biotechnological Inc., China), and purified human IgA
(Imtek, Russia). An antigen solution at concentration
of 2  µg/ml in PBS (137  mM  NaCl, 2.7  mM  KCl, 10  mM
Na
2
HPO
4
, 2  mM  KH
2
PO
4
, pH  7.4) was used to immo-
bilize an antigen overnight at 4°C in the wells of a
96-well flat-bottomed plate (MaxiSorp, Nuns). Control
wells did not contain antigen and were further pro-
cessed in parallel with the rest of experimental wells.
The wells were washed with PBS three times, then
blocked in a 1% solution of bovine serum albumin
(BSA) in PBS for one hour and washed twice with PBS.
The tested nAbs in a 0.1% BSA solution in 1×PBS were
applied to the wells at different concentrations, mostly
in the range of 0.4-1 μg/ml, and incubated for 1  h with
occasional stirring. The wells were washed thoroughly
(5 times in PBS) and horseradish peroxidase-conjugat-
ed secondary mouse anti-HA tag antibodies (Sigma-
Aldrich) diluted 1  :  2000 in a 0.1%  BSA/PBS were added.
After 1  h, the wells were again washed thoroughly
and then a 1-Step Ultra TMB indicator mix (Thermo
Scientific, USA) was added. 2 M sulfuric acid was used
to stop the reaction. Optical density was measured at
a wavelength of 450  nm with a flatbed photometer.
Thedata were obtained in three repeats.
RESULTS AND DISCUSSION
For many years, our laboratory has been con-
ducting research related to the production of new
single-domain antibodies (nAbs) for a wide range of
target antigens and aimed at solving urgent problems
in biomedicine. At present, for a number of ongoing
projects of the laboratory, creation of bispecific nAbs
on the basis of obtained nAbs has been required. For
this purpose, a bacterial expression system (E. coli) is
preferable, since it is in the periplasm of bacteria that
we routinely produce nAbs and their derivatives. Pre-
viously, our laboratory has already conducted experi-
ments on production of two nAbs in a single reading
frame with coding sequences separated by a linker.
However, this revealed problems of instability of the
resulting constructs in bacteria (unusually high muta-
genesis was detected by sequencing and PCR analysis
of different resulting clones) and very low yield of re-
combinant protein with two nAb modules (below the
level of background bacterial proteins). These prob-
lems emerged both when using the traditional linker
(Gly4-Ser)×3 and the linker based on the long hinge
site of camelid specific antibodies, consisting of 28  aa.
In this work, previous experience was taken into ac-
count and an even longer combined linker between
the sequences encoding nAb was proposed. Figure  1
shows the scheme of the structure of expression con-
struct based on the plasmid vector pHEN6 [26] for in-
ducible expression of bispecific nAb in the periplasm
of E.  coli, as well as two variants of the developed
linkers (to the best of our knowledge such elongated
linkers have not been suggested before).
The linker 1 (52  aa) consists of a long hinge re-
gion of camelid specific antibodies (28  aa) connected
to the conventional Gly
4
-Ser-Gly
4
-Ser-Gly
4
linker (as in
phagemid pIT2) with several additional amino acid
residues, and in the linker 2 (86  aa), an additional
BISPECIFIC NANOANTIBODIES 937
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 1. Scheme of the expression construct used for synthesis of bispecific nAbs and sequence of the linkers separating the se-
quences encoding nAbs. Designations from left to right: lactose promoter site (Plac/operator); ribosome binding site (RBS); trans-
lation initiation (arrow); signal peptide for periplasmic localization (pelB); sequences encoding nAbs (VHH1 and VHH2) separat-
ed by the linker sequence (amino acid sequences of the used linkers are indicated at the bottom of the figure); HA-tag sequence
(YPYDVPDYA) and six histidine residues at the very end. ILZ,trimerizing domain, “isoleucine zipper.”
sequence of the recombinant trimerizing “isoleucine
zipper” domain, ILZ, is incorporated between the two
indicated parts of the linker1 [8]. It has been previous-
ly shown that nAbs to which the ILZ domain has been
added are indeed efficiently trimerized in the bacterial
periplasm immediately after their synthesis [8].
In this short communication, examples and pri-
mary characteristics of the first bsNBs obtained using
these two linker variants are presented.
Preparation and analysis of bispecific nAbs
with linker1. In collaboration with our Austrian part-
ners, we have recently succeeded in obtaining nAb
(aBet) to the major birch pollen allergen (Betv  1) [24],
as well as nAb (aICAM1) to the major epithelial sur-
face receptor protein ICAM1 [23]. One of the further
goals of this work was to obtain the bsNBs that bind
to ICAM1 on the surface of human upper respiratory
tract epithelial cells and can then also bind the pollen
allergen coming from an external environment, block-
ing it and thus preventing an allergic reaction. In this
study, we obtained two bsNB variants containing both
nAbs, aBet-L1-aICAM1 and aICAM1-L1-aBet, but in dif-
ferent positions relative to the linker. Interestingly,
the first bsNB variant (in three independent repeats)
was produced markedly and reproducibly better un-
der the same conditions compared to the second vari-
ant (lanes 3 and 4, respectively, in Fig.  2a). The level
of production for the aBet-L1-aICAM1 bsNTs was quite
comparable to the average level of production for the
original single-module nAbs (approximately 2  mg from
1  liter of culture). The detectable bsNBs moved in elec-
trophoresis gel in full agreement with the expected
size of 36  kDa. At the concentration of 0.4 μg/ml, both
bsNBs specifically recognized each of the immobilized
antigens, Betv  1 and ICAM1 (Fig.  2b). Thus, these pre-
liminary data indicate that it is feasible to produce the
specified bsNBs in soluble and active form in the bac-
terial periplasm. Relative location of these two differ-
ent nAb sequences in the construct may be important
for the level of production.
Preparation and analysis of bispecific nAb with
linker 2. In our other current project, the task is to de-
velop means to block/detain pathogenic respiratory vi-
ruses in the upper respiratory tract of humans based
on bispecific nAbs. To do this, we have obtained and
continue to obtain both nAbs that specifically bind
conservative surface epitopes of the current pathogen-
ic viruses (primarily influenza viruses and coronavi-
ruses), and nAbs to major components of mucus or, in
particular, to major immunoglobulin (IgA) of mucous
tissues. By binding to the viral particle, IgA molecules
cause opsonization of the pathogen and give the im-
mune system a signal to destroy it. It was previously
shown that it is preferable to use trimerized nAb to
bind and block the virus [8]. In order to study how the
addition of ILZ to the linker affects production of bsNB,
in this work we tested the second version of the linker
(linker 2, Fig.  1). This time, two other previously ob-
tained nAbs were used. One, aHN13, binds hemagglu-
tinin (HA) of the avian influenza virus (H5N2) [8], and
the other (E7) binds the human IgA [25]. The expected
size of the monomeric version of this bsNB is approx-
imately 39  kDa, which is in good agreement with the
mobility of the protein detected by electrophoresis
under reducing conditions (Fig. 3a), under which the
putative nascent trimer breaks down into monomers.
TILLIB, GORYAINOVA938
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 2. Results of SDS-PAGE and ELISA for bispecific aBet-L1-aICAM1 and aICAM1-L1-aBet nanoantibodies. a) Electrophoret-
ic separation of proteins from periplasmic extracts in a 5-19% gradient SDS-polyacrylamide gel (1, 2) and affinity-purified
bsNBs(3,4). The arrow shows position of the bispecific nanoantibodies (bsNBs). The marker(M) is shown in the leftmost lane
and sizes of the protein marker bands are indicated (in kilodaltons, kDa). b)Immunoassay of binding of the obtained bsNBs
at concentration of 0.4μg/ml to the immobilized recombinant antigens (shown at the bottom). Mean values of three measure-
ments are presented with the area of data scatter.
Fig. 3. Results of SDS-PAGE and ELISA for bsNB aHA-L2-E7 (aIgA), also denoted (HN-E7)×3. a)Electrophoretic separation of the
affinity-purified bsNB in a 5-19% gradient SDS-polyacrylamide gel: initial preparation(1), after filtering through a filter with
a nominal molecular weight cutoff of 100kDa(2), presumably, trimerized bsNB retained over a filter with molecular weight
cutoff of 100kDa purified from small impurities(3). The arrow shows position of monomeric bsNB. The marker(M) in the
rightmost lane is labeled and sizes of the marker bands are indicated (in kilodaltons, kDa). b)Immunoassay of binding of the
obtained bsNB (HN-E7)×3 as well as control monovalent nAbs (E7– against IgA and HN13– against HA-H5 hemagglutinin of
avian influenza virus) at concentration of 1μg/ml with immobilized recombinant antigens (IgA and HA-H5). Control wells were
antigen-free (no AG). Mean values of three measurements are presented with the area of data scatter.
In the case of trimerization, the size of bsNB
should increase to about 117kDa. In this short report,
we have not yet set the task of thoroughly studying tri-
merization of the resulting bsNB, but two facts could
be pointed out as indirect indications of trimerization
of the produced protein. First, during ultrafiltration us-
ing a centrifuge concentrator with a nominal molecular
weight cutoff of 100kDa (Vivaspin Turbo4, Sartorius),
BISPECIFIC NANOANTIBODIES 939
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
this bsNB behaves as a high molecular weight protein
and is almost completely concentrated above the filter,
whereas other protein molecules contaminating the
initial preparation of bsNB and having a size (in the
electrophoregram) of up to 75 kDa pass through the
filter noticeably, in contrast to the nAT moving in de-
naturing electrophoresis as a 39  kDa monomeric pro-
tein. Another indication are difficulties in isolation of
this bsNB in the composition of periplasmic extract.
Based on the assumption of its three-dimensional
structure, we specifically selected conditions for more
efficient extraction of this bsNB from bacterial peri-
plasm. We added a cell wall disruption procedure with
lysozyme and increased ionic strength of the elution
solution (details in the methods description). Produc-
tion rate for the aHA-L2-E7 bsNB using the modified
extraction conditions was also comparable to the av-
erage production rate of the original single-module
nAb (approximately 1  mg from 1  liter of culture). The
resulting bsNB had the required functionality and rec-
ognized both target proteins in ELISA (Fig. 3b). The
monomeric nAbs taken as positive controls, anti-IgA
(E7) [25] and nAb against the HA-H5 hemagglutinin of
avian influenza virus (HN13) [8], gave a slightly stron-
ger signal upon binding. This may reflect the twofold
molar excess of these monospecific nAbs compared to
the proportion of E7 and HN13 in the bispecific nAb
(at the same concentration of all three nAb variants),
and may also indicate possible steric limitations when
the presumably trimerized bsNB are used in this assay.
Note that for comparison this bsNB was also prepared
with the linker1 (aHA-L1-E7), without the trimerizing
domain. The yield of bsNB was 2-fold higher in this
case. All three variants of the described bsNBs could
not be produced in the detectable amounts at all, when
shorter conventional linkers are used.
Thus, we have demonstrated that the produced
bispecific nAbs contain all defined domains in a func-
tional state: they are released from periplasm, His-tag
is functional for the protein isolation with the help
of affinity metal-chelate chromatography, and both
antigen-recognizing modules of nAbs and HA-tag are
functional in immunoassays. Longer linker sequences
apparently contribute to the weakening of undesirable
interactions (potential recombinations) between the
conserved GC-rich core sites in the consecutive VHH
sequences in the case of heterologous bacterial expres-
sion system, which is reflected in the stability of con-
structs (producers) and in the increased production of
these bispecific nAbs. We assume that our work is the
first one considering the use of such elongated linkers
for the purpose of increasing efficiency of production
of bispecific nanobodies in periplasm. The obtained
results definitely are encouraging for further develop-
ments of the similar variants of nAb derivatives for a
wide range of current biomedical problems.
Patent application for the invention has been filed
to protect priority right of the developments described
in this article [27].
Contributions. S.V.T. concept and management of
work, performing cloning, and further functional ver-
ification of nAb in enzyme immunoassay; O.S.G. and
S.V.T. experiments on production and isolation of nAbs;
S.V.T. and O.S.G. writing the article.
Funding. This work was financially supported by
the Ministry of Science and Higher Education of the
Russian Federation (Agreement No. 075-15-2021-1086,
contract No.RF–193021X0015).
Ethics declarations. This work does not contain
any studies involving human and animal subjects per-
formed by any of the authors. The authors of this work
declare that they have no conflicts of interest.
REFERENCES
1. Hamers-Casterman,C., Atarhouch,T., Muyldermans,S.,
Robinson,G., Hamers,C., Songa, E.B., Bendahman,N.,
and Hamers, R. (1993) Naturally occurring anti-
bodies devoid of light chains, Nature, 363, 446-448,
doi:10.1038/363446a0.
2. Flajnik, M.F., and Kasahara,M. (2010) Origin and evo-
lution of the adaptive immune system: genetic events
and selective pressures, Nat. Rev. Genet., 11, 47-59,
doi:10.1038/nrg2703.
3. Bannas,P., Hambach,J., and Koch-Nolte,F. (2017) Na-
nobodies and nanobody-based human heavy chain
antibodies as antitumor therapeutics, Front Immunol.,
8, 1603, doi:10.3389/fimmu.2017.01603.
4. Jovčevska, I., and Muyldermans, S. (2020) The thera-
peutic potential of nanobodies, BioDrugs, 34, 11-26,
doi:10.1007/s40259-019-00392-z.
5. Tillib, S. B. (2020) Prospective applications of sin-
gle-domain antibodies in biomedicine [in Russian],
Mol. Biol. (Mosk.), 54, 362-373.
6. Stone,E., Hirama,T., Tanha,J., Tong-Sevinc,H., Li,S.,
MacKenzie, C. R., and Zhang, J. (2007) The assem-
bly of single domain antibodies into bispecific de-
cavalent molecules, J. Immunol Methods, 318, 88-94,
doi:10.1016/j.jim.2006.10.006.
7. Hultberg, A., Temperton, N. J., Rosseels, V., Ko-
enders,M., Gonzalez-Pajuelo,M., Schepens,B., Ibañez,
L. I., Vanlandschoot, P., Schillemans, J., Saunders, M.,
Weiss, R. A., Saelens, X., Melero, J. A., Verrips, C. T.,
Van Gucht, S., and de Haard, H. J. (2011) Llama-de-
rived single domain antibodies to build multivalent,
superpotent and broadened neutralizing anti-viral
molecules, PLoS One, 6, e17665, doi: 10.1371/journal.
pone.0017665.
8. Tillib,S., Ivanova, T.I., Vasilev, L.A., Rutovskaya, M.V.,
Saakyan, S.A., Gribova, I.Y., Tutykhina, I.L., Sedova,
TILLIB, GORYAINOVA940
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
E. S., Lysenko, A. A., Shmarov, M. M., Logunov, D. Y.,
Naroditsky, B.S., and Gintsburg, A. L. (2013) Format-
ted single-domain antibodies can protect mice against
infection with influenza virus (H5N2), Antiviral Res.,
97, 245-254, doi:10.1016/j.antiviral.2012.12.014.
9. Huet, H.A., Growney, J.D., Johnson, J.A., Li,J., Bilic,S.,
Ostrom, L., Zafari, M., Kowal, C., Yang, G., Royo, A.,
et al. (2014) Multivalent nanobodies targeting death
receptor 5 elicit superior tumor cell killing through
efficient caspase induction, mAbs, 6, 1560-1570,
doi:10.4161/19420862.2014.975099.
10. Laursen, N. S., Friesen, R. H. E., Zhu, X., Jongeneel-
en, M., Blokland, S., Vermond, J., van Eijgen, A.,
Tang,C., van Diepen,H., Obmolova,G., van der Neut
Kolfschoten,M., Zuijdgeest,D., Straetemans,R., Hoff-
man, R.M.B., Nieusma,T., Pallesen,J., Turner, H.L.,
Bernard, S.M., Ward, A.B., Luo,J., Poon, L.L.M., Tre-
tiakova, A.P., Wilson, J.M., Limberis, M.P., Vogels,R.,
Brandenburg, B., Kolkman, J. A., and Wilson, I. A.
(2018) Universal protection against influenza infec-
tion by a multidomain antibody to influenza hemag-
glutinin, Science, 362, 598-602, doi: 10.1126/science.
aaq0620.
11. Efimov, G. A., Kruglov, A. A., Khlopchatnikova, Z. V.,
Rozov, F.N., Mokhonov, V.V., Rose-John,S., Scheller,J.,
Gordon, S., Stacey, M., Drutskaya, M. S., Tillib, S. V.,
and Nedospasov, S.A. (2016) Cell-type-restricted anti-
cytokine therapy: TNF inhibition from one pathogen-
ic source, Proc. Natl. Acad. Sci. USA, 113, 3006-3011,
doi:10.1073/pnas.1520175113.
12. Hanke,L., Das,H., Sheward, D.J., Perez Vidakovics,L.,
Urgard, E., Moliner-Morro, A., Kim, C., Karl, V., Pan-
kow,A., Smith, N. L., Porebski, B., Fernandez-Capetil-
lo, O., Sezgin, E., Pedersen, G. K., Coquet, J. M., Häll-
berg, B. M., Murrell, B., and McInerney, G. M. (2022)
A bispecific monomeric nanobody induces spike tri-
mer dimers and neutralizes SARS-CoV-2 in vivo, Nat.
Commun., 13, 155, doi:10.1038/s41467-021-27610-z.
13. Liu, Y., Ao, K., Bao, F., Cheng, Y., Hao, Y., Zhang, H.,
Fu, S., Xu, J., and Wu, Q. (2022) Development of a
bispecific nanobody targeting CD20 on B-cell lympho-
ma cells and CD3 on T cells, Vaccines (Basel), 10, 1335,
doi:10.3390/vaccines10081335.
14. Ma,H., Zhang,X., Zeng,W., Zhou,J., Chi,X., Chen, S.,
Zheng,P., Wang,M., Wu,Y., Zhao,D., Gong,F., Lin,H.,
Sun, H., Yu, C., Shi, Z., Hu, X., Zhang, H., Jin, T., and
Chiu, S.A. (2022) A bispecific nanobody dimer broad-
ly neutralizes SARS-CoV-1 & 2 variants of concern and
offers substantial protection against Omicron via low-
dose intranasal administration, Cell Discov., 8, 132,
doi:10.1038/s41421-022-00497-w.
15. De Marco, A. (2015) Recombinant antibody produc-
tion evolves into multiple options aimed at yield-
ing reagents suitable for application-specific needs,
Microb. Cell Factories, 14, 125, doi: 10.1186/s12934-
015-0320-7.
16. Sandomenico,A., Sivaccumar, J.P., and Ruvo,M. (2020)
Evolution of Escherichia coli expression system in pro-
ducing antibody recombinant fragments, Int. J. Mol.
Sci., 21, 6324, doi:10.3390/ijms21176324.
17. Huleani, S., Roberts, M. R., Beales, L., and Papaioan-
nou, E. H. (2022) Escherichia coli as an antibody ex-
pression host for the production of diagnostic pro-
teins: significance and expression, Crit. Rev. Biotech-
nol., 42, 756-753, doi:10.1080/07388551.2021.1967871.
18. Skerra, A., and Plückthun, A. (1988) Assembly of a
functional immunoglobulin Fv fragment in Esch-
erichia coli, Science, 240, 1038-1041, doi: 10.1126/
science.3285470.
19. Le Gall, F., Reusch, U., Little, M., and Kipriyanov,
S. M. (2004) Effect of linker sequences between the
antibody variable domains on the formation, stabil-
ity and biological activity of a bispecific tandem dia-
body, Protein Eng. Des. Sel.,
17, 357-366, doi:10.1093/
protein/gzh039.
20. Wang, Q., Chen, Y., Park, J., Liu, X., Hu, Y., Wang, T.,
McFarland, K., and Betenbaugh, M. J. (2019) Design
and production of bispecific antibodies, Antibodies
(Basel), 8, 43, doi:10.3390/antib8030043.
21. Huang, C., Huang, J., Zhu, S., Tang, T., Chen, Y., and
Qian, F. (2023) Multivalent nanobodies with ratio-
nally optimized linker and valency for intravitreal
VEGF neutralization, Chem. Eng. Sci., 270, 118521,
doi:10.1016/j.ces.2023.118521.
22. Roobrouck, A., and Stortelers, C. (2015) Bispecific na-
nobodies. Applicant – ABLYNX NV (Belgium). WIPO/
PCT patent publication number WO2015044386 A1.
Publication date April 2, 2015.
23. Zettl, I., Ivanova, T., Zghaebi, M., Rutovskaya, M. V.,
Ellinger, I., Goryainova, O., Kollárová, J., Villazala-
Merino, S., Lupinek, C., Weichwald, C., Drescher, A.,
Eckl-Dorna,J., Tillib, S.V., and Flicker, S. (2022) Gen-
eration of high affinity ICAM-1-specific nanobodies
and evaluation of their suitability for allergy treat-
ment, Front. Immunol., 13, 1022418, doi: 10.3389/
fimmu.2022.1022418.
24. Zettl, I., Ivanova, T., Strobl, M. R., Weichwald, C., Go-
ryainova, O., Khan, E., Rutovskaya, M. V., Focke-
Tejkl,M., Drescher,A., Bohle,B., Flicker,S., and Tillib,
S. V. (2022) Isolation of nanobodies with potential to
reduce patients’ IgE binding to Bet v 1, Allergy, 77,
1751-1760, doi:10.1111/all.15191.
25. Goryainova, O. S., Ivanova, T. I., Rutovskaya, M. V.,
and Tillib, S. V. (2017) A method for the parallel and
sequential generation of single-domain antibodies
for the proteomic analysis of human blood plas-
ma, Mol. Biol. (Mosk.)., 51, 985-996, doi: 10.7868/
S0026898417060106.
26. Conrath, K.E., Lauwereys,M., Galleni,M., Matagne,A.,
Frère, J.M., Kinne,J., Wyns,L., and Muyldermans,S.
(2001) Beta-lactamase in-hibitors derived from
single-domain antibody fragments elicited in the
BISPECIFIC NANOANTIBODIES 941
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Camelidae, Antimicrob. Agents Chemother., 45, 2807-
2812, doi:10.1128/AAC.45.10.2807-2812.2001.
27. Tillib, S. V., and Goryaynova, O. S. (2024) Bispecific na-
nobodies with extended linker sequences between an-
tigen-recognition modules for production in the peri-
plasm of E.coli, Russian Federation Patent Application
No.2024101830, FIPS, Moscow.
28. Baral, T.N., and Arbabi-Ghahroudi,M. (2012) Expres-
sion of single-domain antibodies in bacterial systems,
Methods Mol Biol., 911, 257-275, doi: 10.1007/978-1-
61779-968-6_16.
29. Laemmli, U.K. (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4,
Nature, 227, 680-685, doi:10.1038/227680a0.
Publisher’s Note. Pleiades Publishing remains
neutral with regard to jurisdictional claims in pub-
lished maps and institutional affiliations.