ISSN 0006-2979, Biochemistry (Moscow), 2024, Vol. 89, No. 5, pp. 942-957 © Pleiades Publishing, Ltd., 2024.
942
In vitro and in vivo Evaluation of Antifibrotic Properties
of Verteporfin in a Composition of a Collagen Scaffold
Olga S. Rogovaya
1,a
*, Danila S. Abolin
1
, Olga L. Cherkashina
1
, Artem D. Smyslov
1
,
Ekaterina A. Vorotelyak
1
, and Ekaterina P. Kalabusheva
1
1
Koltzov Institute of Developmental Biology, Russian Academy of Sciences, 119334 Moscow, Russia
a
e-mail: rogovaya26f@yandex.ru
Received December 6, 2023
Revised March 5, 2024
Accepted March 31, 2024
Abstract— Extensive skin damage requires specialized therapy that stimulates regeneration processes without
scarring. The possibility of using combination of a collagen gel application as a wound dressing and fibroblast at-
tractant with verteporfin as an antifibrotic agent was examined in vivo and in vitro. In vitro effects of verteporfin
on viability and myofibroblast markers expression were evaluated using fibroblasts isolated from human scar
tissue. In vivo the collagen gel and verteporfin (individually and in combination) were applied into the wound
to investigate scarring during skin regeneration: deviations in skin layer thickness, collagen synthesis, and ex-
tracellular matrix fibers were characterized. The results indicate that verteporfin reduces fibrotic phenotype by
suppressing expression of the contractile protein Sm22α without inducing cell death. However, administration
of verteporfin in combination with the collagen gel disrupts its ability to direct wound healing in a scarless
manner, which may be related to incompatibility of the mechanisms by which collagen and verteporfin control
regeneration.
DOI: 10.1134/S0006297924050146
Keywords: dermal fibroblasts, fibrosis, skin regeneration, verteporfin, YAP/TAZ
Abbreviations: BrdU, 5-bromo-2′-deoxyuridine; BSA,bovine
serum albumin; DPBS, Dulbecco’s phosphate-buffered sa-
line; PFA,paraformaldehyde; VP,verteporfin.
* To whom correspondence should be addressed.
INTRODUCTION
Wound healing is a complex process, which is
commonly considered to be divided into sequential
partly overlapping four phases: hemostasis, inflamma-
tion, proliferation (cell infiltration, angiogenesis, and
re-epithelialization), and maturation/remodelling [1].
At the phase of inflammation activation of immune
cells stimulates secretion of cytokines, which, in turn,
activate migration of fibroblasts, epithelial and endo-
thelial cells to the damaged area. In the wound bed
fibroblasts acquire activated phenotype and are trans-
formed into Sm22 positive myofibroblasts, which are
cells responsible for generation of main components
of extracellular matrix such as fibronectin with extra
domain  A, collagen  I and  III, required for filling-in
defects of connective tissues and scar formation [2-4].
Remodelling phase is the final phase of wound heal-
ing, which could take years. At this stage under nor-
mal conditions architecture of the restored tissue is
close to the structure of normal skin [1].
When the damage is very extensive, specialized
agents are used to stimulate regeneration process.
Tissue equivalents based on the collagen gel are suc-
cessfully introduced into the medicine practice [5].
Biodegradability of collagen and its low immunoge-
nicity make it an optimal base not only for tissue en-
gineering involving design of constructs containing
collagen-based scaffolds and live cells, but also for de-
veloping collagen-based wound dressings [6-8]. Colla-
gen, as a key element of extracellular matrix, affects
all stages of wound healing [9-11]. Collagen hydrogels
partially reproduce properties of extracellular matrix,
have porous structure with a network of protofibrils
enabling migration and colonization of cells, thus fa-
cilitating remodelling of the de novo formed tissue and
wound healing [12]. In some cases, the collagen-based
COLLAGEN SUPPRESSES ANTIFIBROTIC PROPERTIES OF VP 943
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
skin substitutes contain biologically active molecules:
growth factors, cytokines or their analogues that stim-
ulate the processes of integration of the tissue equiva-
lent into the damaged organ, regeneration of the adja-
cent tissues, and modulation of immune response.
One of the often complications of skin regenera-
tion, especially in the cases of extensive damages such
as burns requiring specialized therapy, is formation
of hypertrophic scars [13]. In addition to obvious cos-
metic issues, scars disrupt mechanical interactions in
the skin making it more fragile and prone to rapture.
Scars do not contain hair follicles and accompanying
sebaceous glands, which promotes drying of epider-
mis. One of the newest and most promising therapeu-
tic preparations for anti-scar therapy is verteporfin
(VP) [14-17].
Single administration of VP to mice at the early
stages of regeneration initiated the process of scar-
less healing[18]. VP also exhibits bactericidal activity,
which produces beneficial effects on would healing
[16]. Delivery of VP to the damage area for stimulation
of wound healing was successfully performed using
agents based on fibroin [15], polyvinyl [17], and poly-
lactide [14]. We investigated the possibility of using
collagen gel as a VP delivery agent to the wound, in
order to prevent scar formation after complete wound
healing.
The anti-scar properties of VP are considered to
be associated with its ability to inhibit interaction of
the transcription cofactor YAP1 with its targets from
the family of TEAD proteins. Activation of the YAP1
signaling cascades occurs during wound healing both
in epidermis and in dermis [19]. In epidermis it stim-
ulates migration and proliferation of keratinocytes in
the wound bed. Active nuclear YAP1 is associated with
proliferation of fibroblasts and increase of their con-
tractile ability, which is important for wound closing.
Activity of this signaling cascade decreases at the stage
of remodeling. Increase of the duration of activity of
the YAP1 signaling cascade in mice results in forma-
tion of common or hypertrophic scars, at the same
time, its inhibition in fibroblasts at the early stages of
wound healing stimulates regeneration of a fully func-
tional skin with all derivates [20].
Effect of VP on scarring processes were examined
both in vitro and in vivo. For the in vitro studies hu-
man fibroblasts isolated from hypertrophic skin scar
were applied as an analogue of myofibroblasts of the
wound bed. Effect of VP on viability, expression of con-
tractile markers, and contractile ability of fibroblasts
were examined. In the in vivo studies with laboratory
mice, efficiency of VP administration in composition of
collagen gel for stimulation of skin regeneration was
investigated. The following parameters were analyzed:
rate of the wound closure, structure of extracellular ma-
trix, and general morphology of the regenerated skin.
MATERIALS AND METHODS
Isolation and cultivation of dermal fibroblasts.
Cells lines used in the study were isolated from hu-
man skin biopsies obtained in the course of recon-
structing surgeries in the Vishnevsky National Med-
ical Research Center for Higher Technologies with
informed consent of the donors. Experiments with
skin biopsies were performed in accordance with the
protocol approved by the Bioethics Committee of the
Koltzov Institute of Developmental Biology, Russian
Academy of Sciences (IDB) (no.  51 from 09.09.2021).
Biopsy samples were washed with a Hank’s solution
(PanEco, Russia) supplemented with 0.4  mg/ml of
gentamycin (BioFarmGarant, Russia) for disinfection,
next, subcutaneous fat and reticular layer of dermis
were removed mechanically in such a way that the up-
per layer of skin with epidermis was no thicker than
2  mm. Dermis with epidermis were cut into 2-3  mm
bands and incubated in a 2% Dispase solution (Gibco,
USA) for 1 h at 37°C; in the next step epidermis was
removed, dermis was cut by scissors to homogenous
state and incubated in 0.1% collagenase type  I solution
(Gibco) for 24  h at 37°C. The obtained mass was cen-
trifuged at 140g for 10  min, precipitate was resuspend-
ed in a DPBS (Dulbecco’s phosphate-buffered saline;
PanEco); this procedure was repeated three times.
To isolate scar fibroblasts normal tissues were re-
moved from the biopsy sample, only regions with pro-
nounced scarring deformation were preserved, which
was followed by incubation of the sample for 1 h in a
2% Dispase solution at 37°C. After removal of epider-
mis, dermis was cut with scissors to homogenous state
and incubated in a 0.1% Liberase solution (Roche,
USA) for 24 h at 37°C. The obtained sample was centri-
fuged at 140g for 10  min; precipitate was resuspended
in DPBS; procedure was repeated 3 times.
Isolated fibroblasts were cultivated in 25  cm
2
cul-
ture flasks an Amniomax-II medium (Gibco) under
conditions of 5%  CO
2
and 37°C. Culture medium was
replaced every 2-3  days. After reaching confluency,
cells were detached using a 0.05% trypsin-EDTA solu-
tion (Capricorn, Germany) followed by cultivation in
a DMEM medium (PanEco) supplemented with 10%
fetal bovine serum (Capricorn), 1%  Glutamax (Cibco),
1%  penicillin-streptomycin (Gibco). Cells after 2-3  pas-
sages were used in the study.
Samples of a healthy skin obtained from three
42-55 years old donors, and samples obtained from
the 33-45 years old donors with scar tissues were used
in the study. Produced cell lines were deposited to the
IDB collection of cell lines for biotechnological and
biomedical studies (general biology and biomedical
section).
Detection of apoptosis. In order to determine
type of the cell death, fibroblasts were detached from
ROGOVAYA et al.944
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Table 1. Sequences of primers used in the study
Gene name Forward primer Reverse primer
GAPDH CCATGTTCGTCATGGGTGTG GGTGCTAAGCAGTTGGTGGTG
HPRT ACCAGGTTATGACCTTGATT AAGTTGGCCTAGTTTATGTT
YAP AGAGAATCAGTCAGAGTGCTCCA TTCAGCCGCAGCCTCTCC
TAZ GGCAATGATTAAACTGGCAACA AGTGAGCCCTTTCTAACCTGG
CTGF TGTGCACCGCCAAAGATG CAGACGAACGTCCATGCTG
CYR61 AAGGAGGCCGTCCTGGTC GGGCTGCATTCCTCTGTGT
EDA-FN CCCTAAAGGACTGGCATTCA CATCCTCAGGGCTCGAGTAG
CD26 AGAAGGAGTATTCAATAAGTGGGAC TACTCTGCTCTGTGGTGGTCT
COL1 AGAAAGGGGTCTCCATGGTG AGGACCTCGGCTTCCAATAG
COL3 CCAGGAGCTAACGGTCTCAG TGATCCAGGGTTTCCATCTC
the surface 1, 3, and 5 days after treatment with VP,
centrifuged at 140g for 5  min, washed once with DPBS,
followed by incubation for 15 min in a solution of
annexin  V and propidium iodide using an apoptosis
detection kit PI-AV (BDPharmingen
TM
, USA) according
tomanufacturer instructions. To introduce compensa-
tion coefficient to the results of analysis, samples
stained separately with annexinV and propidium io-
dide were used. Flowcytometry analysis was carried
out with an Attune®NxT flow cytometer (Life Technolo-
gies, USA).
Cultivation of fibroblasts in a collagen gel.
Topre pare gel, a 0.34  M  NaOH solution (Khimmed, Rus-
sia) – 6.5%; 7.5%  Na
2
CO
3
solution (PanEco) – 3.42%;
10×  M199  medium (Gibco)– 9.77%; Glutamax (Gibco)–
0.39%; Hepes (PanEco) – 1.95% collagen type  I solu-
tion – 77,97% were mixed on ice. Collagen solution
was prepared from the standard laboratory rat tail
tendons: individual fibers were separated mechani-
cally and dissolved in a 0.1% acetic acid, final concen-
tration– 2  µg/ml. Gel aliquots (400  µl) containing cell
suspension (150  × 10
3
cells perml) were inoculated into
wells of 24-well plate (Corning, USA) and incubated
at 37°C for polymerization. Culture medium (500  µl)
was added on top of the gel. Gel was separated from
the culture well walls, which facilitated unlimited con-
traction of the gel by cells.
One day after the gel formation, VP (Sigma-Al-
drich) solution in a culture medium at concentration
0.1  µg/ml was added to experimental wells followed by
incubation with the cells for 24  h followed by washing
the gel once with a Hank’s solution and immersing the
gel into a regular culture medium.
Quantitative PCR analysis. RNA was isolated
with the help of a RNAzol reagent (Sigma-Aldrich, Ger-
many) according to the manufacturer’s instructions.
AQuantiTect Reverse Transcription Kit (Qiagen, USA)
was used for genomic DNA removal and perform-
ing reverse transcription. One µg of RNA was used
for reverse transcription reaction. Real-time quan-
titative PCR was carried out using a 5×  qPCRmix-HS
SYBR+LowROX reagent kit (Evrogen, Russia) and a
LightCycler96 amplifier (Roche). Reaction protocol:
10  min at 95°C, 1  cycle; next 45  cycles including 20  s
at 95°C, 20  s at 60°C, 30  s at 72°C. All experiments
were performed in three biological and technical rep-
licates. Amount of product in each sample was cal-
culated using the 2
–ΔΔCq
method and normalized to
expression of GAPDH and HPRT. Data on the graphs
are presented as mean ± standard deviation. Sequenc-
es of the primers used in the study are presented
in Table1.
Incorporation of BrdU label and determination
of the cell cycle stage. Fibroblasts (500  ×  10
3
  cells)
were seeded into 25  cm
2
culture flasks (Corning) and
cultured for 1  day. Next, VP was added at concentra-
tion 0.1  µg/ml. Concentration of VP was determined
previously (unpublished data) with consideration of
the literature data [18] and cultivation was continued
for 1 day followed by removal of VP with replacing
culture medium. Next, a BrdU label (5-bromo-2′-deoxy-
uridine; Sigma-Aldrich) was introduced on the day  1,
3, and 5of cultivation to final concentration 30 µM fol-
lowed by 2-h incubation. Cells were detached, washed
with DPBS, and fixed in a 70% ethanol solution for 1  h
at 4°C. Next cell was precipitated by centrifugation for
COLLAGEN SUPPRESSES ANTIFIBROTIC PROPERTIES OF VP 945
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Table 2. Antibodies used in the study
Antibodies Manufacturer, cat. no. Dilution Fluorophore
Primary anti-BrdU rat IgG Abcam, ab6326 1/100 –
Primary goat IgG against Sm22α Abcam, ab10135 1/100 –
Primary rabbit IgG against YAP1 Abcam, ab52771 1/100 –
Primary rabbit IgG against YAP1 Cell Signaling Technology, D8H1X 1/100 –
Primary rabbit IgG against collagen I+III Imtek (Russia), RAP c13 1/20 –
Primary goat IgG against P-cadherin R&D Systems, AF761 1/20 –
Primary rat IgG against E-cadherin Abcam, ab11512 1/20 –
Secondary donkey IgG against rabbit IgG Invitrogen, 32790 1/1000 Alexa 488
Secondary donkey IgG against goat IgG Life Technologies, A11056 1/1000 Alexa 546
Secondary goat IgG goat against rat IgG Life Technologies, A11081 1/1000 Alexa 546
2  min at 1000g; 0.5  ml of 2  M  HCl (Khimreaktiv, Rus-
sia) containing 0.5%  Triton  X-100 (MP Biomedicals,
USA) was added to the precipitate and incubated for
30  min at room temperature. Cell was precipitated, su-
pernatant was removed, and cells were resuspended
in 0.5  ml of 0.1  M sodium tetraborate (Khimmed, Rus-
sia). The mixture was incubated for 2  min and, next,
washed once with 150  µl of DPBS/1%  BSA (bovine se-
rum albumin; PAA, Austria), and next incubated with
50  µl of a primary antibody solution in DPBS with ad-
dition 0.5%  Tween  20 (MP  Biomedicals) and 1%  BSA
for 1  h at room temperature. Cells were washed once
with DPBS and incubated in a solution of secondary
antibodies for 30  min at room temperature (manu-
facturers and dilutions of antibodies are presented
in Table  2). Next, cells were resuspended in 0.5  ml
of DPBS containing 10  µg/ml of RNAse  A (Fermentas,
Canada) and 20  µg/ml of propidium iodide solution
(Sigma-Aldrich) followed by 30-min incubation in the
dark. Cells stained with relevant secondary antibodies
and non-stained cells were used as controls. Flow cy-
tometry was carried out using an Attune® NxT flow
cytometer.
Immunofluorescent staining of collagen gels.
Gels were fixed with a 4% solution of paraformalde-
hyde (PFA) (Sigma-Aldrich) for 40  min, washed once
with DPBS, and permeabilized in a DPBS solution con-
taining 1%  Tween  20, 1%  Triton  X-100, and 5%  BSA
for 1  h at room temperature. Next, primary antibod-
ies at concentrations shown in Table  2 were added
and incubated for 12  h at 4°C. Next, the samples were
washed with permeabilizing solution for 2  h followed
by addition of the corresponding secondary antibod-
ies conjugated with fluorophores (Table 2) and 12-h
incubation at 4°C. Nuclei were stained with DAPI (Bi-
otium, USA) at concentration 1  µg/ml. Imaging and
image analysis was carried out with the help of an
Olympus IX  73 fluorescence microscope (Olympus,
Japan).
Surgical procedures. Male C57Bl6 mice (n = 24)
at the age of 8 weeks were used in the study. All exper-
iments were conducted with animal under general an-
esthesia in accordance with the International Guiding
Principles for Biomedical Research Involving Animals
[21,  22]. Animal were kept with free access to water
and feed.
Mice were divided into the following groups: Con-
trol(n  =  6), VP(n  =  6), Gel(n  =  6), and Gel  +  VP(n = 6).
Animals were anesthetized with isoflurane VetFarm,
Russia). Hair was shaved between the shoulder blades,
and surgical area was disinfected with 70% alcohol.
Ketoprofen solution (50 mg/ml, Ellara, Russia) was in-
jected into a surgical area. A 5-mm diameter circle was
cut from all layers of the skin. To prevent rapid con-
traction, a silicone ring (splint) with diameter corre-
sponding to the wound size was applied, the ring was
glued with a BF-6 glue (Tulskaya Farmatsevticheska-
ya Fabrika, Russia) and fixed in place with 8 surgical
stiches using a nonabsorbable suture (Resolon, Germa-
ny). The wound was rinsed and 250 µl of collagen gel
(‘Gel’ group), 100µl of VP solution in PBS with concen-
tration 1 mg/ml (‘VP’ group), or 250  µl of collagen gel
with VP (‘Gel  +  VP’ group at the rate 100  µg of VP per
mouse) were administered into the wound of animals
in experimental groups. In the ‘Control’ group 100  µl
of PBS solution with added DMSO (dilution 1/1) was
ROGOVAYA et al.946
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
applied to the wound. Wounds were covered with a
Tagaderm film (3M, Germany) and fixed with a ban-
dage (Omniplast, Germany).
Collagen gel for introduction into wounds was
prepared the same way as in the case of fibroblast
cultivation. Gel (250  µl) was placed into the wells of a
48-well plate (Corning) and incubated at 37°C for po-
lymerization.
State of wounds in animals was examined every
other day, and additional sutures were applied to the
silicon rings if required. Wounds were photographed
once a week.
All abovementioned agents were introduced once
more into the wounds after 3 days. On the day 21 of the
experiment the animals were euthanized, post-mortem
7-8  mm diameter biopsy samples including entire skin
thickness were taken from the wounds.
Handling of wound biopsy samples and histo-
logical staining. Wound biopsies were embedded into
a Tissue-Tek medium (Sakura, Japan) forming cryob-
locks by incubation first in nitrogen vapour and, next,
immersing them into liquid nitrogen several times
for 3-5  s until completely frozen; samples were stored
at–70°C. Cryosections of the samples with 8  µm thick-
ness were prepared with a Leica CM1950 cryostat
(Leica,Germany).
Sections were fixed in a 4% PFA solution, stained
with a hematoxylin-eosin stain (BioVitrum, Russia) ac-
cording to the manufacturer’s protocol, and embedded
into a Bio Mount medium (BioOptica, Italy). Imaging
of the stained samples was carried out with a Keyence
BZ-9000 microscope (Keyence,Japan).
For immunofluorescence analysis, sections were
fixed in a 4%  PFA  solution, incubated in a solution of
primary antibodies containing 5%  BSA, 1%  Triton  X-100,
and 1%  Tween  20 for 18  h, primary antibodies were
next removed by washing in DPBS, and incubated with
solution of secondary antibodies for1.5  h. Imaging of
the samples was carried out with a Leica Thunder mi-
croscope (Leica). List of the antibodies and their con-
centration are shown in Table  2.
Analysis of collagen fibers architecture. Archi-
tecture of collagen fibers was analyzed in the samples
stained with hematoxylin-eosin. Dermis in the wound
area was imaged with 40×  magnification, the obtained
images were analyzed with the help of CurveAlign and
CT-FIREalgorithms [23,24].
The CurveAlign algorithm analyzes the degree of
alignment of collagen fibers in an image and con-
structs heat map of the fiber orientation; CT-FIRE uses
curvelet transformation to suppress noise in the im-
age and determine boundaries of collagen fibers, and,
next, extracts information and analyzes parameters of
individual collagen fibers (length, width, straightness,
angle) [23,  24]. The obtained data were statistically
processed.
Statistical analysis. Statistical data processing
was carried out with the help GraphPadPrism 9 pro-
gram. Prior to selection of statistical criterium each
data set was analyzed for normality of distribution
(Shapiro–Wilk test, Kolmogorov–Smirnov test, D’Agos-
tino–Pearson combined test, Anderson–Darling test).
In the case of normal data distribution differences be-
tween groups were analyzed with the help of one-way
analysis of variance (ANOVA) with post hoc Tukey test
for multiple comparisons, or with the help of two-way
ANOVA supplemented with the Sidak test for pairwise
comparisons. In the case of deviation from normal dis-
tribution differences between the data were analyzed
with the Kruskal–Wallis test and post hoc Dunn’s test
for multiple comparisons. Presence of outliners in the
data was determined with the help of Dixon’s  Q test.
The data obtained with the help of algorithms for
analysis of collagen fiber architecture were processes
using the OriginPro 2022 software. Principal compo-
nent analysis was performed based on the results ob-
tained with the help of these algorithms. The graphs
show 95% confidence intervals for each group of data.
K-means clustering was performed to identify similar
data sets.
RESULTS
Effect of VP on viability of normal and scar-de-
rived fibroblasts. At the first stage of the study, we
evaluated effect of VP on viability of normal and
scar-derived human skin fibroblasts. For this pur-
pose, the cell cultures were treated with VP solution
for 24  h and, next, number of live and dying cells was
determined with the help of propidium iodide and an-
nexin  V staining after 1, 3, and 5 days of cultivation
(Fig.  1, a and b). Live cells were identified based on
lack of staining with propidium iodide and annexinV.
The level of proliferation was determined based on the
number of cells with incorporated BrdU (Fig. 1c).
No statistically significant changes in the number
of live/dying cells after treatment with VP were ob-
served. However, treatment with VP significantly de-
creased proliferation in the normal and scar-derived
fibroblasts one day after treatment. Three days af-
ter treatment the levels of proliferation between the
control (norm and scar) and experimental groups
(norm  +  VP, scar  +  VP) groups differed not very sig-
nificantly, but the decreasing trend was observed.
On the fifth day after treatment the scar-derived fi-
broblasts exhibited tendency for increased level of
proliferation in the ‘VP’ group in comparison with
the control group. Interestingly enough, prolifer-
ation decreased in the groups not treated with VP
from day 1 to 5. This is associated with the contact
inhibition in the course of reaching the confluence.
COLLAGEN SUPPRESSES ANTIFIBROTIC PROPERTIES OF VP 947
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 1. Evaluation of the number of dead and proliferating fibroblasts of different types (norm and scar) under the action of VP.
a)Fraction of live cells after treatment with VP. b)Fraction of dying cells after treatment with VP. c)Number of proliferating
cells. Data are presented as a mean ± standard deviation. Statistically significant differences: **p≤0.01 and ****p≤0.0001.
ROGOVAYA et al.948
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 2. Analysis of cell cycle of normal(norm) and scar-derived(scar) fibroblasts after VP treatment. Data are presented as
amean ± standard deviation.
Considering that the analysis did not reveal any dif-
ferences in the cell death, but showed differences in
proliferation, we decided to analyze of the cell cycle
(Fig.2).
No statistically significant changes in distribution
of cells according to the cell cycle phases after treat-
ment with VP were observed. Nevertheless, this dia-
gram allows suggesting that the decrease in prolifera-
tion is due to delay in the G1 phase.
Effect of VP on behaviour of dermal fibroblasts
in a collagen gel. Fibroblasts placed into the collagen
gel after just one day form contacts with the colla-
gen fibrils acquiring elongated phenotype typical for
this type of cells. At the same time fibroblasts initiate
contraction of the gel. Incubation in the presence of
0.1  µg/ml ofVP was carried out for 24  h in the half of
the prepared gels; culture medium with added DMSO
was used as a control. Evaluation of the gel size was
estimated 3, 5, and7days after treatment(Fig.  3a). Re-
sults of the analysis demonstrated that VP initially de-
creases the degree of gel contraction in both types of
investigated fibroblasts. The scar-derived fibroblasts
preserved their fibrotic properties during cultivation
and contracted gel to a greater degree in comparison
with the normal fibroblasts. The analyzed gels visual-
ly contained the same number of cells; hence, intensi-
ty of contraction was determined by the characteris-
tics of fibroblasts.
Expression of Sm22α, one of the markers of my-
ofibroblasts mediating their contractile capacity, was
investigated using immunofluorescent techniques [25-
27]. Expression of the elements of the YAP1 signaling
pathway was also evaluated, because VP is an inhibi-
tor of this cascade [28,29](Fig.3).
COLLAGEN SUPPRESSES ANTIFIBROTIC PROPERTIES OF VP 949
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 3. Effect of VP treatment on contractile capacity and phenotypes of different types of fibroblasts (norm and scar) in the
collagen gels. a)Dynamics of collagen gels contraction. b)Immunofluorescent identification of Sm22α(green) and YAP1(red).
Cells with cytoplasmic localization of YAP1 are shown in insets at high magnification. Nuclei are stained with DAPI. Confocal
microscopy. Scale bar: 100µm.
The scar-derived fibroblasts contained a larger
fraction of Sm22α-positive cells; this difference was
most pronounced at the day 5 of cultivation. VP treat-
ment significantly decreased the Sm22α expression
in both investigated groups. Expression of YAP1 after
exposure to VP also decreased after 3 and 5 day of
cultivation. On the day 3 of cultivation, the cells not
containing nuclear form of YAP1 were observed in the
cultures treated with VP. At the day 5 of cultivation,
cells containing nuclear active form of YAP1 were
again detected in all cultures (Fig.  3b).
Expression of myofibroblasts markers, proteins
of extracellular matrix: collagens type I and III (COL1,
COL3) and fibronectin containing extra domain A
(EDA-FN), as well as CD26, was evaluated 5 days af-
ter exposure of the fibroblasts in collagen gel to VP
(Fig.  4). Expression of YAP1 and its paralogue TAZ was
evaluated at the same time, because increase of their
expression occurs in the course of skin regeneration
and during formation of hypertrophic scars, as well
as of their typical targets CTGF and CYR61. Analysis
of the data obtained with real-time PCR did not reveal
ROGOVAYA et al.950
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 4. Quantitative PCR analysis of fibrotic markers expressed by different types of fibroblasts (norm and scar) in the collagen
gel 5 days after exposure to VP. Data are shown as a mean ± standard deviation. Results were normalized to the level of GAPDH
expression. Statistically significant difference of the levels of expression in the scar-derived fibroblasts in comparison with
normal fibroblasts: *p<0.05; **p<0.01; ***p<0.001. Statistically significant difference of the levels of expression in compar-
ison with the ‘Norm+VP’ group: #p<0.05; ##p<0.01.
any significant differences in the groups of fibroblasts
exposed to VP. However, difference between the fibro-
blasts from normal skin and from scar tissues was sta-
tistically significant (Fig.4).
Effect of VP on skin morphology in the course
of post-traumatic regeneration. VP was introduced
to mice after creation of an artificial splinted wound
in composition of a collagen gel or as a solution at
the early stages of wound healing. This protocol was
based on the previously published data reporting re-
sults of a single administration of VP into the wound
area [17, 18,20]. Wounds were imaged every 7 days to
assess the rate of their closure (Fig. 5a).
Major number of wounds was closed at the day14.
At the day 22 after surgery the wound area was vi-
sually indistinguishable from the normal skin (Fig.  5,
a  and  b). The most pronounced differences in the rate
of wound closure were observed at the day 7 after
surgery. The wounds in the presence of collagen gel
(groups ‘Gel’ and ‘Gel  +  VP’) were closing slower over
the first week in comparison with the groups with-
out gel (‘Control’ and ‘VP’) (Fig.  5c). At the same time,
COLLAGEN SUPPRESSES ANTIFIBROTIC PROPERTIES OF VP 951
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 5. Analysis of dynamics of wound healing based on morphometric parameters. a) Morphology of wounds in different
groups at the day 0, 7, 14, and 22 after surgery; b)dynamics of wound closure over the 22-day experiment; c)rate of wound clo-
sure in the first week. ***p<0.001 in comparison with control group; ###p<0.001 in comparison with VP group. d)Epidermis
thickness in the wound area. e)Dermis thickness in the wound area, *p<0.05. The data are presented as a mean ±standard
deviation.
ROGOVAYA et al.952
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 6. Immunofluorescence detection of wound healing markers (collagens I+III, P-cadherin, E-cadherin, YAP) in the skin section
from the wounds at the day 22 after surgery in different groups of mice. Fluorescence microscopy. Scale bar: 100µm.
there were no differences in the rates of wound heal-
ing between the groups with VP exposure (‘Gel  +  VP’
and ‘VP’) and the corresponding groups of mice with-
out VP exposure (‘Gel’ and ‘Control’)(Fig.5,bandc).
Histological examination of skin sections revealed
decrease of the dermis thickness in the ‘VP’ group
(Fig.  5e). Epidermis thickness (Fig.  5d) in the wound
area was approximately the same in all groups.
Immunofluorescence analysis revealed lower con-
tent of the collagens type  I and III in the ‘VP’ group
(Fig.  6). Despite the capacity of VP to inhibit the YAP1
signaling [28,  29], the level of active nuclear form of
this protein in all dermis samples was the same, as well
as in part of the cells of the basal layer of epidermis
independent on the presence of VP.
To examine the state of regenerating dermis, analy-
sis of collagen fibers in the histological samples of
the skin wounds was performed on the day 22 after
surgery with the help of CT-FIRE and CurveAlign al-
gorithms (Fig.  7a). Increase of the length, width, and
straightness of individual fibers as well as their align-
ment relative to each other indicate pronounced fibro-
sis, which implies slower remodelling process. Signif-
icant deviation from the control group characterizes
the process of skin regeneration as pathological.
Data obtained with the help of CurveAlign and
CT-FIRE were processed using principal component
analysis to reduce dimensions. No significant differ-
ences in the collagen morphology were revealed be-
tween the groups ‘Control’ and ‘VP’ after evaluation of
all parameters (Fig. 7,b  and  c). Both the samples from
the ‘Control” group and from the ‘VP’ group contained
more straightened and longer fibers, which could be
typical for the fibrotic stage of normal wound healing
[30]. Such samples with more pronounced fibrotic phe-
notype formed a separate cluster (Fig.7b;Cluster1).
Introduction of VP into the collagen gel (‘Gel  +  VP’
group) resulted in the increase of width, length, and
straightness of the fibers in comparison with the wounds
with only collagen gel(‘Gel’ group, Fig.7,dande).
Combining all four groups in one common space
of principal coordinates (Fig.  7,fandg) did not demon-
COLLAGEN SUPPRESSES ANTIFIBROTIC PROPERTIES OF VP 953
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 7. Digital analysis of collagen fibers in histological preparations of mice skin samples obtained 22 days after surgery:
a)Visualization of the steps of analysis of collagen fiber structure in histological preparations using heatmaps constructed with
the help of CT-FIRE and CurveAlign algorithms. b)Principal component analysis for the ‘Control’ and ‘VP’ groups based on the
CT-FIRE and CurveAlign data. c)Directions of initial coordinate axes in the principal components space. d)Principal compo-
nent analysis for the ‘Gel’ and ‘Gel+VP’ groups based on the CT-FIRE and CurveAlign data. e)Directions of initial coordinate
axes in the principal components space. f)Principal component analysis for all experimental groups based on the CT-FIRE and
CurveAlign data. g)Directions of initial coordinate axes in the principal components space.
ROGOVAYA et al.954
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
strate any separations between the groups ‘Control’,
‘VP’, and ‘Gel’, whilethe group ‘Gel  +  VP’ deviates from
all other groups. Major part of the observations from
the ‘Gel  +  VP’ group is located in the separate cluster
(Fig.  7f; Cluster  1). Collagen fibers in this cluster are
characterized with greater length, width, straightness,
and degree of alignment, which could indicate larger
extent of fibrotic changes in the dermis.
DISCUSSIONS
In the course of this study potential effects of VP
in combination with collagen gel on the mechanisms
of post-traumatic skin regeneration were evaluated.
Preservation of fibrotic properties by the scar-de-
rived fibroblasts during cultivation has been con-
firmed with immunohistochemical staining (Fig.  3b)
and quantitative PCR analysis (Fig.  4), which demon-
strate significantly higher expression of the myofibro-
blast markers in comparison with the control group.
The mechanism of VP action in the mouse wounds
are commonly associated with elimination of myo-
fibroblasts positive for Engrailed 1 and CD26 from
the damage area by inhibiting the YAP/TAZ signaling
[18, 20, 29]. It was shown in our in vitro experiments
that VP does not cause death of the cells, including
those isolated from the scar with pronounced fibrot-
ic phenotype. VP decreases proliferation at the first
day of cultivation, but the level of proliferation is re-
stored to control levels in the following days (Fig. 1),
hence, exposure to VP leads to the elimination of my-
ofibroblasts not by their death, but by altering their
of their expression profile from expression of fibrot-
ic markers to the expression profile typical for nor-
mal skin.
VP significantly decreases contractile capability
of fibroblasts (Fig.  3a). This is associated with the de-
crease of the fraction of cells positive for expression
of the contractile protein Sm22α already at the day 3
after exposure to VP (Fig.  3b).
Exactly at that time the cells not containing ac-
tive nuclear form of the YAP1 protein were observed.
Atthe day 5 expression profile of the specialized mark-
ers of myofibroblasts was analyzed using quantitative
PCR analysis (Fig.  4). At this time, we did not observe
any statistically significant differences between the
groups under exposure to VP and without it in terms
of expression of both protein of extracellular matrix
and other fibrotic markers, CD26 and YAP/TAZ protein.
Activity of the YAP1 signaling was restored, which was
manifested by the lack of differences in the expression
of its targets CTGF and CYR61. Hence, VP exhibited
most pronounced effects on the dermis fibroblasts in
culture exactly at the early stages suppressing expres-
sion of contractile proteins resulting in the decrease of
contraction for up to 7 days, which prolonged its anti-
fibrotic action.
The wound healing in mice is a process signifi-
cantly different from the process observed in humans
[31]. Contraction is more pronounced in the mouse
skin, which facilitates closure of even large wounds
within a few days. We used splinted wound model in
our study to prevent contraction, which makes the
process of wound healing in mice closer to the simi-
lar process in a human [32]. VP was introduced into a
wound either on its own or in composition of a colla-
gen gel. The state of regenerating skin was evaluated
on the day 22 at the stage of remodelling in order to
obtain detailed characteristics of the process.
At early stages collagen gel slowed down the pro-
cess of wound closure, however, after the day 14 the
damaged area contracted with the same intensity in-
dependent on the particular group (Fig.  5). Nuclear
YAP1 was detected in the dermis and epidermis at the
day 22, which indicated restoration of activity of this
signaling cascade (Fig.  6). Addition of VP and colla-
gen gel separately or in combination did not result in
the changes of the majority of skin morphological
parameters, however, VP introduced separately into
the wound decreased thickness of the dermis in re-
generating skin (Fig. 5) and intensity of expression of
collagen  I and  III in it (Fig.  6), which indicates its an-
ti-scarring effect [33]. To evaluate the manifestations
of fibrosis in the course of skin regeneration modern
methods of computer-assisted analysis of extracellular
matrix morphology were used [23, 24]. Introduction
of VP in the composition of collagen gel (‘Gel  +  VP’
group) resulted in formation of fibers with larger
length, width, and straightness (Fig. 7, b and c). For-
mation of such fibers indicates fibrotic direction of
the wound healing process [34]. Furthermore, analy-
sis of the parameters characterizing morphology of
collagen fibers did not reveal any statistically signif-
icant differences between the groups ‘VP’ and ‘Gel’
and the ‘Control’ group. Although application of VP
and collagen gel do not change morphology of col-
lagen fibers, their use, which is important, does not
lead to activation of fibrosis. Hence, despite the posi-
tive effect of VP administration, its combination with
collagen gel affected regeneration process in a neg-
ative way. Unlike in our study, success of VP admin-
istration in composition of specialized carriers was
observed only in the cases when the carriers com-
prised not a single layer covering the wound area, but
microparticles containing VP [12, 14, 15]. The result
observed in our study could be explained by several
mechanisms underlying the effects of collagen gel and
VP on wound healing. VP modulated behavior of fi-
broblasts preventing contraction of the collagen gel
(Fig.  3a) and decreasing expression of fibrotic markers
(Fig.  4). Collagen gel, in turn, stimulates more intensive
COLLAGEN SUPPRESSES ANTIFIBROTIC PROPERTIES OF VP 955
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
formation of granulation tissue, which accelerates re-
generation process [35, 36]. It is likely that VP inhibit-
ed formation of the pool of myofibroblasts, which, in
turn, slowed down the stage of proliferation and re-
modelling and caused the observed manifestations of
fibrosis.
CONCLUSIONS
Development of tissue engineering constructs
stimulating wound healing, but not resulting in scar
formation is very important for the patients with
burns and other pathologies. VP is one of the most
promising antifibrotic preparations, hence, the pos-
sibility of its use in composition of therapeutics stim-
ulating regeneration processes has been considered
[18, 20,29]. Collagen gels are also used for skin wound
closing [6-8]. It was shown in our study that com-
bined application of the collagen gel and VP enhanced
fibrosis during wound healing. Hence, the current way
of VP administration into the wound does not facili-
tate regeneration; that is why the possible carriers of
VP for wound healing require further investigation.
Application of the constructs containing dermal fibro-
blasts and epidermal keratinocytes stimulated skin
regeneration more effectively in comparison with
application of empty carriers [37], hence, addition of
cellular component could help to optimize properties
of the gel with preserving its regenerative potential.
As was shown in our in vitro experiments, VP did not
cause cell death, but prevented fibrotic changes in the
cellular component in the composition of the collagen
gel. Hence, dermal fibroblasts inside the carriers could
preserve their normal phenotype after exposure to VP
and after transplantation to the area of skin damage.
This possibility should be examined in future studies,
as well as optimization of the composition of special-
ized carrier.
Acknowledgments. Cell lines used in the study
were provided by the Collection of Cell Cultures of the
Center for Collective Usage of the Institute of Develop-
mental Biology, Russian Academy of Sciences. Equip-
ment from the Center for Collective Usage of the In-
stitute of Developmental Biology, Russian Academy of
Sciences, was used in the study.
Contributions. O.S.R., A.D.S., and K.E.P. were re-
sponsible for conducting in vitro experiments; S.A.D.
performed quantitative PCR analysis; O.S.R., A.D.S.,
Ch.O.L., and K.E.P. performed experiments with labora-
tory animals; Ch.O.L. performed bioinformatics analy-
sis of distribution of extracellular matrix fibers in the
wound area; O.S.R., V.E.A., and K.E.P. development of
the study design; O.S.R., Ch.O.L., and K.E.P. preparation
of the text of the paper; V.E.A. editing text of the paper.
Funding. The study was financially supported by
the Russian Science Foundation (project no.21-74-30015,
https://rscf.ru/en/project/21-74-30015/).
Ethics declarations. All procedures performed in
studies involving human participants were in accor-
dance with the ethical standards of the institutional
and/or national research committee and with the 1964
Helsinki declaration and its later amendments or com-
parable ethical standards. All applicable international,
national, and/or institutional guidelines for the care
and use of animals were followed. The authors of this
work declare that they have no conflicts of interest.
REFERENCES
1. Cañedo-Dorantes,L., and Cañedo-Ayala,M. (2019) Skin
acute wound healing: a comprehensive review, Int.J.
Inflamm., 2019, 3706315, doi:10.1155/2019/3706315.
2. Xue,M., and Jackson, C.J. (2015) Extracellular matrix
reorganization during wound healing and its impact
on abnormal scarring, Adv. Wound Care, 4, 119-136,
doi:10.1089/wound.2013.0485.
3. Karppinen, S.-M., Heljasvaara, R., Gullberg, D.,
Tasanen, K., and Pihlajaniemi, T. (2019) Toward un-
derstanding scarless skin wound healing and patho-
logical scarring, F1000Res., 8, 787, doi: 10.12688/
f1000research.18293.1.
4. Tomasek, J. J., Gabbiani, G., Hinz, B., Chaponnier, C.,
and Brown, R. A. (2002) Myofibroblasts and mecha-
no-regulation of connective tissue remodelling, Nat.
Rev. Mol. Cell Biol., 3, 349-363, doi:10.1038/nrm809.
5. Eudy,M., Eudy, C.L., and Roy,S. (2021) Apligraf as an
alternative to skin grafting in the pediatric popula-
tion, Cureus, 13, e16226, doi:10.7759/cureus.16226.
6. Dibbs, R.P., Depani,M., and Thornton, J.F. (2022) Tech-
nical refinements with the use of biologic healing
agents, Semin. Plast. Surg., 36, 008-016, doi: 10.1055/
s-0042-1742749.
7. El Masry, M. S., Chaffee, S., Das Ghatak, P., Mathew-
Steiner, S.S., Das,A., Higuita-Castro,N., Roy,S., Anani,
R.A., and Sen, C.K. (2019) Stabilized collagen matrix
dressing improves wound macrophage function and
epithelialization, FASEBJ., 33, 2144-2155, doi:10.1096/
fj.201800352R.
8. Parenteau-Bareil,R., Gauvin,R., and Berthod,F. (2010)
Collagen-based biomaterials for tissue engineering
applications, Materials, 3, 1863-1887, doi: 10.3390/
ma3031863.
9. Mouw, J.K., Ou,G., and Weaver, V.M. (2014) Extracel-
lular matrix assembly: a multiscale deconstruction,
Nat. Rev. Mol. Cell Biol., 15, 771-785, doi: 10.1038/
nrm3902.
10. Hynes, R.O. (2014) Stretching the boundaries of extra-
cellular matrix research, Nat. Rev. Mol. Cell Biol., 15,
761-763, doi:10.1038/nrm3908.
ROGOVAYA et al.956
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
11. Mathew-Steiner, S. S., Roy, S., and Sen, C. K. (2021)
Collagen in wound healing, Bioengineering, 8, 63,
doi:10.3390/bioengineering8050063.
12. Zhang, Y., Wang, Y., Li, Y., Yang, Y., Jin, M., Lin, X.,
Zhuang,Z., Guo,K., Zhang,T., and Tan,W. (2023) Ap-
plication of collagen-based hydrogel in skin wound
healing, Gels, 9, 185, doi:10.3390/gels9030185.
13. Potter, D.A., Veitch,D., and Johnston, G.A. (2019) Scar-
ring and wound healing, Br.J. Hosp. Med. Lond. Engl.,
80, C166-C171, doi:10.12968/hmed.2019.80.11.C166.
14. Chen, K., Liu, Y., Liu, X., Guo, Y., Liu, J., Ding, J.,
Zhang, Z., Ni, X., and Chen, Y. (2023) Hyaluronic ac-
id-modified and verteporfin-loaded polylactic acid
nanogels promote scarless wound healing by acceler-
ating wound re-epithelialization and controlling scar
formation, J. Nanobiotechnol., 21, 241, doi: 10.1186/
s12951-023-02014-x.
15. Wei, C., You, C., Zhou, L., Liu, H., Zhou, S., Wang, X.,
and Guo,R. (2023) Antimicrobial hydrogel micronee-
dle loading verteporfin promotes skin regeneration
by blocking mechanotransduction signaling, Chem.
Eng.J., 472, 144866, doi:10.1016/j.cej.2023.144866.
16. Zhang, C., Yang, D., Wang, T.-B., Nie, X., Chen, G.,
Wang, L.-H., You, Y.-Z., and Wang, Q. (2022) Biode-
gradable hydrogels with photodynamic antibacteri-
al activity promote wound healing and mitigate scar
formation, Biomater. Sci., 11, 288-297, doi: 10.1039/
D2BM01493A.
17. Zhang,Y., Wang,S., Yang,Y., Zhao,S., You,J., Wang,J.,
Cai, J., Wang, H., Wang, J., Zhang, W., Yu, J., Han, C.,
Zhang, Y., and Gu, Z. (2023) Scarless wound healing
programmed by core-shell microneedles, Nat. Com-
mun., 14, 3431, doi:10.1038/s41467-023-39129-6.
18. Mascharak,S., Talbott, H.E., Januszyk,M., Griffin,M.,
Chen,K., Davitt, M.F., Demeter,J., Henn,D., Bonham,
C. A., Foster, D. S., Mooney, N., Cheng, R., Jackson,
P. K., Wan, D. C., Gurtner, G. C., and Longaker, M. T.
(2022) Multi-Omic analysis reveals divergent mo-
lecular events in scarring and regenerative wound
healing, Cell Stem Cell, 29, 315-327.e6, doi: 10.1016/
j.stem.2021.12.011.
19. Lee, M.-J., Byun, M.R., Furutani-Seiki,M., Hong, J.-H.,
and Jung, H.-S. (2014) YAP and TAZ regulate skin
wound healing, J. Invest. Dermatol., 134, 518-525,
doi:10.1038/jid.2013.339.
20. Mascharak, S., desJardins-Park, H. E., Davitt, M. F.,
Griffin, M., Borrelli, M. R., Moore, A. L., Chen, K.,
Duoto,B., Chinta, M., Foster, D. S., Shen, A.H., Janus-
zyk, M., Kwon, S. H., Wernig, G., Wan, D. C., Lorenz,
H.P., Gurtner, G.C., and Longaker, M.T. (2021) Prevent-
ing engrailed-1 activation in fibroblasts yields wound
regeneration without scarring, Science, 372, eaba2374,
doi:10.1126/science.aba2374.
21. International Guiding Principles for Biomedical Re-
search Involving Animals (1985) In The Development
of Science-based Guidelines for Laboratory Animal
Care: Proceedings of the November 2003 International
Workshop; National Academies Press (US), 2004.
22. European Convention for the Protection of Vertebrate
Animals Used for Experimental and Other Scientific
Purposes, URL: https://www.ecolex.org/details/treaty/
european-convention-for-the-protection-of-vertebrate-
animals-used-for-experimental-and-other-scientific-
purposes-tre-001042/.
23. Bredfeldt, J.S., Liu,Y., Pehlke, C.A., Conklin, M.W., Szu-
lczewski, J.M., Inman, D.R., Keely, P.J., Nowak, R.D.,
Mackie, T.R., and Eliceiri, K.W. (2014) Computational
segmentation of collagen fibers from second-harmon-
ic generation images of breast cancer, J.Biomed. Opt.,
19, 16007, doi:10.1117/1.JBO.19.1.016007.
24. Liu,Y., Keikhosravi,A., Mehta, G.S., Drifka, C.R., and
Eliceiri, K.W. (2017) Methods for quantifying fibrillar
collagen alignment, Methods Mol. Biol.
, 1627, 429-451,
doi:10.1007/978-1-4939-7113-8_28.
25. Mussbacher, M., Salzmann, M., Brostjan, C., Hoe-
sel,B., Schoergenhofer,C., Datler,H., Hohensinner,P.,
Basílio, J., Petzelbauer, P., Assinger, A., and Schmid,
J.A. (2019) Cell type-specific roles of NF-κB linking in-
flammation and thrombosis, Front. Immunol., 10, 85,
doi:10.3389/fimmu.2019.00085.
26. Wnuk, D., Lasota, S., Paw, M., Madeja, Z., and Mi-
chalik, M. (2020) Asthma-derived fibroblast to my-
ofibroblast transition is enhanced in comparison
to fibroblasts derived from non-asthmatic patients
in 3D in vitro culture due to Smad2/3 signalling,
Acta Biochim. Pol., 67, 441-448, doi: 10.18388/abp.
2020_5412.
27. Shin, D., and Minn, K. W. (2004) The effect of myofi-
broblast on contracture of hypertrophic scar, Plast.
Reconstr. Surg., 113, 633-640, doi: 10.1097/01.PRS.
0000101530.33096.5B.
28. Wang, C., Zhu,X., Feng,W., Yu, Y., Jeong, K., Guo,W.,
Lu,Y., and Mills, G.B. (2016) Verteporfin inhibits YAP
function through Up-regulating 14-3-3σ sequestering
YAP in the cytoplasm, Am.J. Cancer Res., 6, 27-37.
29. Shi-wen,X., Racanelli,M., Ali,A., Simon,A., Quesnel,K.,
Stratton, R.J., and Leask,A. (2021) Verteporfin inhibits
the persistent fibrotic phenotype of lesional sclero-
derma dermal fibroblasts, J.Cell Commun. Signal., 15,
71-80, doi:10.1007/s12079-020-00596-x.
30. El Ayadi, A., Jay, J. W., and Prasai, A. (2020) Current
approaches targeting the wound healing phases to at-
tenuate fibrosis and scarring, Int.J. Mol. Sci., 21, 1105,
doi:10.3390/ijms21031105.
31. Zlobina, K., Malekos, E., Chen, H., and Gomez, M.
(2023) Robust classification of wound healing stages
in both mice and humans for acute and burn wounds
based on transcriptomic data, BMC Bioinformatics,
24, 166, doi:10.1186/s12859-023-05295-z.
32. Galiano, R. D., Michaels, J., Dobryansky, M., Levine,
J.P., and Gurtner, G.C. (2004) Quantitative and repro-
ducible murine model of excisional wound healing,
COLLAGEN SUPPRESSES ANTIFIBROTIC PROPERTIES OF VP 957
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Wound Repair Regen., 12, 485-492, doi: 10.1111/
j.1067-1927.2004.12404.x.
33. Ud-Din, S., Foden, P., Stocking, K., Mazhari, M.,
Al-Habba,S., Baguneid,M., McGeorge,D., and Bayat,A.
(2019) Objective assessment of dermal fibrosis in
cutaneous scarring, using optical coherence tomog-
raphy, high-frequency ultrasound and immunohisto-
morphometry of human skin, Br. J. Dermatol., 181,
722-732, doi:10.1111/bjd.17739.
34. Henn,D., Chen,K., Fehlmann, T., Trotsyuk, A.A., Siv-
araj,D., Maan, Z.N., Bonham, C.A., Barrera, J.A., Mays,
C.J., Greco, A.H., Moortgat Illouz, S.E., Lin, J.Q., Steele,
S.R., Foster, D.S., Padmanabhan,J., Momeni,A., Nguy-
en,D., Wan, D.C., Kneser,U., Januszyk,M., Keller, A.,
Longaker, M.T., and Gurtner, G. C. (2021) Xenogeneic
skin transplantation promotes angiogenesis and tissue
regeneration through activated Trem
2+
macrophages,
Sci. Adv., 7, eabi4528, doi:10.1126/sciadv.abi4528.
35. Brett, D. A. (2008) Review of collagen and collagen-
based wound dressings, Wounds Compend. Clin. Res.
Pract., 20, 347-356.
36. Ge,B., Wang,H., Li, J., Liu,H., Yin,Y., Zhang, N., and
Qin,S. (2020) Comprehensive assessment of Nile tila-
pia skin (Oreochromis Niloticus) collagen hydrogels
for wound dressings, Mar. Drugs, 18, 178, doi:10.3390/
md18040178.
37. Chermnykh, E.S., Kiseleva, E.V., Rogovaya, O.S., Rip-
pa, A. L., Vasiliev, A. V., and Vorotelyak, E. A. (2018)
Tissue-engineered biological dressing accelerates skin
wound healing in mice via formation of provisional
connective tissue, Histol. Histopathol., 33, 1189-1199,
doi:10.14670/HH-18-006.
Publisher’s Note. Pleiades Publishing remains
neutral with regard to jurisdictional claims in pub-
lished maps and institutional affiliations.