Article

ISSN 0006-2979, Biochemistry (Moscow), 2024, Vol. 89, No. 11, pp. 1911-1921 © Pleiades Publishing, Ltd., 2024.

1911

Study of Neuroinflammation

in the Rat Hippocampus during Ethanol Exposure

and Pharmacological Correction with Azithromycin:

New Data and Future Perspectives

Marat I. Airapetov

1,2,a

*, Sergei O. Eresko

1,3

, Sofiia A. Shamaeva

Evgenii R. Bychkov

, Andrei A. Lebedev

, and Petr D. Shabanov

1,2

Institute of Experimental Medicine, 197376 St. Petersburg, Russia

Military medical academy of S.M. Kirov, 194044 St. Petersburg, Russia

Saint-Petersburg National Research University of Information Technologies, Mechanics and Optics,

197022 St. Petersburg, Russia

e-mail: interleukin1b@gmail.com

Received June 2, 2024

Revised July 7, 2024

Accepted October 9, 2024

Abstract— With prolonged ethanol ingestion, disturbances in the emotional spectrum develop, and memory

problems are noted. These symptoms could be mediated by the development of neurochemical changes in

the hippocampus of the brain. Although there is evidence that hippocampus is vulnerable to chronic alcohol

intoxication and that neuroinflammation and neurodegeneration develop in this brain region, the key molec-

ular mechanisms have not been identified. The aim of the study was to investigate changes in the immune

system in the periphery as well as in the hippocampus of rat brain during ethanol exposure and during

pharmacological correction with azithromycin (AZM). Long-term ethanol exposure was modeled by injecting

rats with a 20% ethanol solution (4 g/kg) for 4 weeks. General biochemical and clinical blood analysis was

performed in animals. Expression levels of the cytokine genes (Il1β, Ccl2, Il6, Il11, Il13, Tnfα, Tgfβ), Toll-like

receptor system genes (Tlr3, Tl4, Tlr7, Nfkb1, Hmgb1), and TLR system-related microRNA molecules (miR-182,

miR-155-5p, miR-96-5p, miR-let-7b) were evaluated in the hippocampus. IL-1β protein content was also assessed

in the hippocampus. Prolonged exposure to alcohol caused increase in the mRNA and protein levels of IL-1β,

and decrease in the mRNA levels of Tnfα, Il11, Tlr3, and Tlr7. The contents of miRlet7b, miR96, and miR155

were downregulated in the hippocampus after long-term alcohol exposure. Elevated levels of THE Il1β mRNA

and protein and Hmgb1 mRNA were maintained under conditions of ethanol abstinence. The Tlr3 mRNA

levels were decreased after abstinence. Administration of AZM reduced the IL1β, TLR3, and HMGB1 mRNA

levels under conditions of ethanol abstinence; and at higher doses of the drug decrease in the IL-1β protein

levels in the hippocampus of rat brain was observed. Thus, the study provided new insights into the mecha-

nisms of neuroinflammation in the hippocampus during prolonged exposure to ethanol and upon abstinence.

The obtained results allowed us to suggest a number of tasks for further studies in this direction.

DOI: 10.1134/S0006297924110051

Keywords: ethanol, hippocampus, Toll-like receptors, cytokines, IL-1β, microRNAs, azithromycin

* To whom correspondence should be addressed.

INTRODUCTION

New publications appear periodically, which

expand our current knowledge on the neuroinflam-

mation theory of alcoholism suggested more than

20years ago that the long-term exposure of an organ-

ism to ethanol activated neuroinflammation mecha-

nisms thus causing development of neurodegeneration

in the brain and, as a result, disruption of the coor-

dinated executive control at the higher level of brain

AIRAPETOV et al.1912

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

Abbreviations: AZM, azithromycin; TLR, Toll-like receptors.

functioning, which, in turn, exacerbate course of the

disease [1-4]. The fact that chronic alcohol consump-

tion causes death of nerve cells is considered nowa-

days as fully established [1-8], however, first obser-

vations of this have been reported in the study by

S.  S.  Korsakoff in 1887  [9]. Later this disorder was

termed Korsakoff’s syndrome (also known as Korsa-

koff’s amnesic syndrome) that develops due to chronic

alcohol intoxication. Almost irreversible memory dis-

order develops in this state, pharmacological interven-

tions are ineffective, and rehabilitation of the patients

with Korsakoff’s syndrome mostly involves adaptation

of the individual to life with limited memory capabil-

ities [6, 8-10]. From the emotional point of view the

patients could exhibit either euphoria and placidity,

or, vice versa, apathy and lethargy  [11]. This syn-

drome is acute manifestation of neurodegeneration,

which could develop on the background of chronic

consumption of ethanol. However, it was shown in

the recent studies that development of the signs of

neurodegeneration could be observed in the course

of experiments with less severe exposure of an or-

ganism to ethanol, i.e., more often, not only in the

case of Korsakoff’s syndrome  [8,  9]. It has been sug-

gested that such pathogenetic processes could occur

during transition from the state of excessive drink-

ing (binge drinking) to early stages alcoholism, which

isfollowed by the development of more severe forms

of alcoholism  [8,  9]. It is likely associated with the

fact that death of the cells in different regions of the

brain chronically exposed to ethanol disrupts coordi-

nated functioning of brain thus affecting processes of

psycho-physiological control of an organism behavior,

which is manifested as symptoms characteristic of al-

coholism – inability to stop drinking, cognitive and

emotional disorders [1, 2, 12, 13].

The data obtained in the course of examination

of the post  mortem samples from the patients with

chronic alcohol consumption reveal presence of neu-

roinflammation developed in the cerebral cortex

[8, 9]. These data allowed suggesting that formation

of alcohol dependence could be associated not only

with dysfunction of neurotransmitter and neuropep-

tide systems, but also is mediated by various factors

of neuroinflammation  [8-11]. The system of Toll-like

receptors (TLR), being a key component of innate im-

munity, participates in regulation of synthesis of nu-

merous inflammatory response factors [1,  2,  14,  15].

This system includes endogenous TLR agonists (such

as Hmgb1 and a number of microRNAs), Toll-like re-

ceptors, and intracellular adapter proteins (including

MyD88, TRIF, IRF, NF-κB1, and others), which initiate

activation of the genes associated with neuroinflam-

mation [1, 2, 14, 15].

Modeling of long-term exposure to ethanol both

in vitro and in vivo allowed establishing that the sys-

tem of Toll-like receptors in nervous tissue cells indeed

responds to ethanol exposure– overexpression of the

TLR genes proteins, of their endogenous agonists has

been reported, as well as overexpression of the genes

of proinflammatory cytokines [1-4]. However, despite

the existence of such knowledge, there is no full un-

derstanding of the mechanisms of the effects of long-

term ethanol consumption on this system in different

regions of the brain. In this regard, the structures com-

prising elements of the so-called brain reinforcement

system associated with the development of alcohol

addiction attract the most attention [16-18]. One of

such key structures is hippocampus [16-18]. It seems

interesting to evaluate levels of expression of the ele-

ments of TLR system and associated molecules in the

hippocampus during modeling of long-term ethanol

exposure and ethanol abstinence, as well as during

pharmacological correction with the help of azithro-

mycin (AZM), which, according to the literature data,

isan effective agent for treatment of neuroinflamma-

tion [19-22]. This was the goal of our study.

MATERIALS AND METHODS

Animals. Three-months old male Wistar rats

(n  =  56) with average body mass 250-300  g were used

in the study, which were purchased in the Rappolovo

laboratory animal facility (Russia). Prior to the exper-

iment animals were divided into groups (8 animals

in each group): control group, group with long-term

exposure to ethanol, five groups with ethanol absti-

nence (ethanol abstinence on the day  7; ethanol ab-

stinence  +  water; ethanol abstinence  +  AZM, 40  mg/kg;

ethanol abstinence  +  AZM, 80  mg/kg; ethanol absti-

nence  +  AZM, 160  mg/kg). Animals have free access to

standard animal feed.

Modeling of long-term ethanol exposure and

state of abstinence was performed according to the

models described in the literature with some modi-

fications [23-25]. Long-term exposure to ethanol was

modeled by intragastric administration of 20% ethanol

solution through a gastric tube at a ratio 4  g of pure

ethanol per 1  kg of body weight on Monday-Friday of

each week for 4  weeks (20 administrations in total).

Control animals received equivalent volumes of water

according to the same scheme. Animals have free ac-

cess to water all the time. Animals in ‘ethanol group’

were decapitated on the last day of ethanol exposure

2  h after the last administration of ethanol. To model

ethanol abstinence, the animals exposed to ethanol

were kept for 7  days without administration of eth-

anol and next were sacrificed by decapitation (group

‘ethanol abstinence, 7 days’).

EFFECT OF ETHANOL ON INFLAMMATION IN HIPPOCAMPUS 1913

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

Table 1. Sequences of primers

Gene

Primers

Forward (5′→3′) Reverse (5′→3′)

Tlr3 AACTGGAGAACCTCCAAGA CACCCTGGAGAAAACTCTTT

Tlr4 ACTCTGATCATGGCATTGTT GTCTCAATTTCACACCTGGA

Tlr7 TGAAAATGGTATTTCCAATGTG TAAGGGTAAGGTTGGTGGTA

Nfκb1 ATACTGCTTTGACTCACTCC AGGTATGGGCCATCTGTT

Hmgb1 CTCTGATGCAGCTTATACGA AAAAGACTAGCTTCCCCTTG

Il1β TGTCTGACCCATGTGAGCTG TTTGGGATCCACACTCTCCAG

Ccl2 AAGATGATCCCAATGAGTCG TGGTGACAAATACTACAGCTT

Tnfα CACGTCGTAGCAAACCAC TATGAAATGGCAAATCGGCT

Il13 TGTAACCAAAAGGCCTCGGA TGGCCATAGCGGAAAAGTTG

Tgfβ GGACTACTACGCCAAAGAAG GGACTACTACGCCAAAGAAG

Il11 GGGACATGAACTGTGTTTGT GGTAGGTAGGGAGTCCAGAT

Il6 ACTTCACAAGTCGGAGGCTT AATTGCCATTGCACAACTCTTTTC

miR-182 TTTGGCAATGGTAGAACTCACACCG GCGAGCACAGAATTAATACGAC

miR-155-5p TTAATGCTAATTGTGATAGGGGT GCGAGCACAGAATTAATACGAC

miR-96-5p TTTGGCACTAGCACATTTTTGCT GCGAGCACAGAATTAATACGAC

miR-let-7b GCGGCGGCTATACAACCTACTGC GCGAGCACAGAATTAATACGAC

U6 TGCTTCGGCAGCACATATAC AGGGGCCATGCTAATCTTCT

Gapdh GCCAGCCTCGTCTCATA GTGGGTAGAGTCATACTGGA

Injection of pharmacological agents. After the

long-term exposure to ethanol the animals were sub-

jected to daily intragastric administration of azithro-

mycin through a gastric tube for three days [40  mg/kg,

80  mg/kg, 160 mg/kg; Hemomycin, powder for prepa-

ration of suspension for oral administration (Hemo-

farm, Serbia)]. Corresponding volume of water was

administered to the rats in control groups (group “eth-

anol abstinence  +  water”). Animals in all ‘ethanol ab-

stinence groups’ were decapitated on the day 7 after

the last ethanol administration.

Sample preparation. Boundaries of brain struc-

tures were determined in accordance with the rat

brain atlas  [26]. Brain samples were immediately fro-

zen at –80°C. Blood was sampled at the moment of

animal decapitation into special tubes for biochemical

and clinical analysis.

Blood analysis. Blood parameters was analyzed

out within first 2  h after sampling with a veterinary

hematological analyzer (Mindray, China). Determina-

tion of biochemical parameters in blood serum was

carried out with an Erba Mannheim XL-100 automatic

analyzer (Germany).

RNA isolation from brain samples. Isolation of

total RNA was carried out using an ExtractRNA re-

agent (Evrogen, Russia) in accordance with the man-

ufacturer’s instruction. Purity and concentration of

obtained RNA were evaluated with an Implen Nano-

Photometer P330 (Implen, Germany) from the A260/

A280 ratio (normal level  ≥  1.8).

RT-PCR. Synthesis of cDNA was carried out us-

ing reverse transcription (RT) in 20  µl of reaction

mixture of a MMLV RT kit (Evrogen) in accordance

with the manufacturer’s instruction. Prior to conduct-

ing RT microRNA were polyadenylated with the help

of poly(A)-polymerase Escherichia coli (New England

Biolabs Inc., USA) according to the previously de-

scribed technique  [27]. RT of microRNA was carried

AIRAPETOV et al.1914

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

in 10  µl volume reaction mixture with a MMLV RT

kit and specific PolyT-adapter (5′-GCGAGCACAGAAT

TAATACGACTCACTATAGGTTTTTTTTTTTTVN-3′).

Concentration of cDNA obtained in the course

of RT was measured with an Implen NanoPhotome-

ter P330.

Polymerase chain reaction (PCR) with real-time

detection was carried out with a Mx3005P amplifier

(Stratagene, USA) in a 10-µl reaction mixture contain-

ing SYBR Green (Evrogen) and a mixture of specific

of forward and reverse primers (Table  1) (Beagle, Rus-

sia). Relative levels of mRNA and miR were calculated

using 2

–ΔΔCt

method, mRNA content was normalized

to the level of expression of the Gapdh gene, level of

miR was normalized to the level of expression of the

U6 gene. All reactions were conducted in triplicate.

Enzyme-linked immunoassay. Frozen hippocam-

pus samples were homogenized with a CRYOMILL

(China) prior to conducting enzyme-linked immuno-

assay (ELIA); next, the obtained frozen powder was

dissolved in 1  ml of PBS (phosphate-buffered saline,

pH 7.4) and centrifuged for 10  min at 3000g. Aliquots

(100  µl) of the collected supernatants were stored

at –80°C before conducting ELIA. Content of IL1β

was determined with the help of an ELIA kit (Cloud-

Clone Corp., USA) according to the provided protocol.

Absorption in the reaction mixture was recorded with

a Synergy  2 plate reader (Bio Tek, USA). Total protein

content was determined using the Bradford method

with a Bio-Rad Protein Assay Kit (Bio-Rad, USA). Mea-

surements were performed in triplicate.

Statistical data processing was carried out using

the Graph Pad Prizm  v.6 software. All data are pre-

sented as a mean  ±  standard deviation of the mean.

Results in different groups were compared using the

Mann–Whitney U-test for small samples. Differences

were considered statistically significant at p ≤ 0.05.

RESULTS AND DISCUSSION

Biochemical and clinical parameter in blood af-

ter long-term exposure to ethanol. To evaluate gen-

eral state of an animal organism during long-term ex-

posure to ethanol we considered reasonable to assess

biochemical and clinical blood parameters in animals.

Results of analysis demonstrated increased lev-

els of alanine aminotransferase (ALT) and albumin

in blood serum of animals in the experimental group

(Table  2). Increased level of albumin could reflect

changes in the degree of dehydration of the organism,

which is typical for the patient with chronic alcoholism,

and the increased level of ALT serves as an indicator

of possible damage of hepatocytes in the experimental

animals, which is also characteristic for an organism

with long-term alcoholic intoxication [8, 28, 29].

The results of clinical blood analysis demonstrat-

ed decrease of the level of lymphocytes and increase

of the level of monocytes in the animals subjected

to long-term exposure to ethanol (Table 3).

The presented results show existence of immune

system response to the long-term exposure of the an-

imal to ethanol. Increase of the level of monocytes

could reflect to a certain degree presence of chron-

ic peripheral inflammatory response, and decrease

of the level of lymphocytes could indicate decrease

of activity of adaptive immune system, which is ob-

served often under conditions of long-term exposure

of the organism to ethanol [29-31].

Table  2. Biochemical parameters of rat blood serum

upon long-term exposure to ethanol

Indicator Control (n = 8) Ethanol (n=8)

ALT, IU/l 18.63 ± 2.91 28.14 ± 5.64*

Glucose, mmol/l 4.39 ± 0.43 4.01 ± 1.08

Creatinine, µmol/l 25.43 ± 7.65 28.16 ± 3.58

Urea, mmol/l 3.48 ± 0.54 4.07 ± 0.36

Albumin, g/l 44.87 ± 3.99 55.43 ± 4.86*

AST, IU/l 69.53 ± 14.67 64.44 ± 6.35

Total protein, g/l 59.30 ± 8.59 67.38 ± 4.48

Note. ALT, alanine aminotransferase; AST, aspartate amino-

transferase; *  p  ≤  0.05 – in comparison with the control

group.

Table  3. Results of clinical analysis of blood samples

of the rats subjected to long-term exposure to ethanol

Indicator Control (n = 8) Ethanol (n = 8)

Leukocytes, 10

/l 8.52 ± 1.82 6.12 ± 2,22

Neutrophils, 10

/l 0.61 ± 0.51 0.98 ± 0,53

Lymphocytes, 10

/l 7.37 ± 2.10 4.01 ± 1.76*

Monocytes, 10

/l 0.5 ± 0.46 1.10 ± 0.69*

Eosinophils, 10

/l 0.03 ± 0.01 0.04 ± 0.02

Basophils, 10

/l 0 ± 0.00 0 ± 0.00

Erythrocytes, 10

/l 8.04 ± 0.41 7.73 ± 0.51

Hemoglobin, g/l 141.5 ± 8.10 145.0 ± 8.74

Hematocrit, % 41.4 ± 1.84 41.9 ± 2.44

Thrombocytes, 10

/l 977.33 ± 156.42 754.01 ± 265.26

Note. *  p  ≤  0.05 in comparison with the control group.

EFFECT OF ETHANOL ON INFLAMMATION IN HIPPOCAMPUS 1915

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

Hence, modeling of the long-term exposure of

an organism to ethanol conducted in this study re-

sulted in certain changes of blood parameters in the

animals, which manifest development of a patholog-

ical state. It should be mentioned that body mass of

the animals in both experimental and control group

did not differ significantly in the course of the ex-

periment, and the animals with signs of one or other

disease (such as acquired trauma) were removed from

the experiment.

Expression of the genes of cytokines and genes

of the TLR system in the hippocampus of rats after

long-term exposure to ethanol. Long-term exposure

to ethanol resulted in the increase of the level of ex-

pression of the Il1β gene and decrease of expression of

the Tnfα and Il11 genes in the rat brain hippocampus

(Fig.  1). No significant differences at the mRNA levels

were revealed in the expression of Il6, Tgfβ, and Il13

(Fig.  1). Product of the Il1β gene is a key proinflamma-

tory cytokine, and increase of its content is often as-

sociated with the development of neuroinflammation.

Increase of its expression in the brain exposed for a

long time to ethanol has been reported in the previous

studies [12,  32,  33]. The results obtained in this study

on the enhanced expression of this gene in the hip-

pocampus of rats subjected to long-term exposure to

ethanol are similar to the previously reported data for

different regions of the brain including hippocampus,

but using different conditions for modeling long-term

ethanol exposure [12,  32,  33]. The level of expression

of the Il6 gene in hippocampus in our experiment did

not change, while expression of the Tnfα gene was

downregulated (Fig.  1). Both cytokines, according to

the latest data, exhibit dual action with regard to the

development of inflammation – in some situations

they play a role of proinflammatory factors, while un-

der other conditions they could exert anti-inflammato-

ry effects  [15,  34]. Hence, no unambiguous conclusions

could be made with regards to the decrease of the

level of expression of the Tnfα gene, further research

is needed to resolve this issue.

Downregulation of expression of the Il11 gene

seems very interesting (Fig.  1). There are data in the

literature indicating that this cytokine in the nervous

tissue exhibits anti-inflammatory effects, which was

demonstrated in the studies modeling various patholo-

gies [35]. It is likely that in this case we observe man-

ifestation of decreased activities of the mechanisms

of inhibition of proinflammatory processes developing

on the background of chronic consumption of etha-

nol. The decreased level of expression of the Il11 gene

could be one of the reasons for dysfunction of these

mechanisms, and further investigation of this cyto-

kine could help to identify a new molecular target to

correct neuroinflammation. This hypothesis requires

future verification.

In addition to cytokines, expression of some

genes of Toll-like receptors was assessed in this study.

Wedid not observe any significant changes in the ex-

pression of the Tlr4, Hmgb1, and Nfκb1 genes, while

expression of the Tlr3 and Tlr7 genes was downregu-

lated (Fig. 2). In the previous studies the researchers

reported increase in the level of expression of the

Tlr7 gene, which was associated with manifestations

of neurodegenerative process [1,  5]. It is likely that

the observed differences between the results of ours

and other studies is due to the regional peculiarities

of expression of this gene, or due to the use of dif-

ferent model of long-term exposure to moderate doses

of ethanol.

It was observed in our previous studies that there

were only minimal changes in the TLR system under

condition of long-term exposure to ethanol, however,

Fig.  1. Content of cytokine mRNAs in the hippocampus of

rats subjected to long-term ethanol exposure; *  p  ≤  0.05 in

comparison with the control group.

Fig.  2. Relative level of mRNAs of the TLR system genes in

the hippocampus of rats subjected to long-term exposure

to ethanol; *  p  ≤  0.05 in comparison with the control group.

AIRAPETOV et al.1916

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

Table  4. Relative level of expression of microRNAs

in the hippocampus of the rats, arb. units

miR Control (n = 8) Ethanol (n=8)

miRlet7b 0.78 ± 0.13 0.43 ± 0.19*

miR96 1.08 ± 0.34 0.38 ± 0.15*

miR155 0.96 ± 0.37 0.51 ± 0.25*

miR182 1.01 ± 0.25 0.79 ± 0.17

Note. * p < 0.05 in comparison with the control group.

abstinence from the long-term ethanol exposure

caused pronounced disbalance in their expression[36-

38]. In particular, the similar results were obtained

for in the nucleus accumbens of the rat brain in the

similar model of long-term exposure to ethanol [37].

Hence, it seems interesting to investigate the mRNA

and protein levels of cytokines, as well as other com-

ponents of TLR-signaling pathway not only under

conditions of long-term exposure to alcohol, but also

under conditions of alcohol abstinence.

Investigation of the content of microRNAs in

hippocampus of the rats subjected to long-term

exposure to ethanol. Analysis of relative content

of microRNA molecules in the hippocampus of the

rats revealed that the levels of miRlet7b, miR96, and

miR155 changes significantly in the group of animals

subjected to long-term exposure ethanol: the level

of the miRlet7b decreased 1.8-fold, of the miR96 –

2.8-fold, and of the miR155 – 1.9-fold (Table  4).

The miR molecules tested in our study were se-

lected on the basis of their functional association with

the TLR-signaling pathways [39-43]. It is known that

miR-let7b is an endogenous agonist of TLR7 [1,  12].

It has been reported that the change in expression of

miR-let7b could have functional association with the

TLR7-signaling cascade [5, 12].

Increase of the content of miR-155 in the microg-

lia cells of the mice was observed with increase of ac-

tivity of TLR-signaling, while in the mice with knock-

out of the Tlr4 gene (TLR4-KO) no such increase was

observed [41]. Content of miR-96 in the cerebral cortex

does not change in the TLR4-KO mice, while long-term

exposure of the wild type mice to alcohol decreased

the level of miR-96[42,  43]. The data are available ex-

emplified with miR-182-5p that indicate existence of

functional interactions of the miR-183C cluster (that

include miR-96 and miR-182) with the TLR4 protein

[42,  43]. It is also worth mentioning that not only the

content of miR-let7b (endogenous agonist for TLR7)

was decreased in our experiments, but also the level

of Tlr7 mRNA, which emphasizes importance of fur-

ther research aiming at establishing possible function-

al association between the observed changes.

Expression of the genes of cytokines and of the

TLR system in rat brain hippocampus under condi-

tions of ethanol abstinence. There is no information

on the state of the investigated system of genes under

conditions of ethanol abstinence. Few facts available

in this regard were mainly obtained either during

modeling of chronic and sub-chronic forms alcohol

addiction or on the next day after abstinence [2,  13].

In our present experiment we analyzed expression of

the investigated genes on the day 7 after abstinence

from the long-term ethanol exposure (Fig. 3).

The obtained results revealed that 7 days after

abstinence expression levels of the genes Tlr3, Tlr4,

Tlr7, and Hmgb1 were increased, while expression of

the Nfκb1 gene did not change (Fig. 3). The highest

increase of expression was observed for the Tlr4 gene.

The obtained data allows suggesting involvement of

the system of Toll-like receptors into pathogenic mech-

anisms in the brain hippocampus developing on the

background of long-term exposure of an organism

to ethanol. It was observed in our experiments that

the levels of expression of the Tlr3 and Tlr7 genes in

hippocampus decreased in the group of animals sub-

jected to long-term exposure to ethanol(Fig.  2), while

increase of the levels of their expression was ob-

served under conditions of ethanol abstinence (Fig.  3).

The obtained results are in agreement with the data

obtained by other researchers for other brain struc-

tures, as well as for the biopsies from the patients

with chronic alcohol intoxication [2,  13,  24]. It was

shown in a series of studies devoted to elucidation

of functional significance of such changes that the

increase of expression of the Tlr4 and Hmgb1 genes

resulted in activation of the genes of proinflammatory

cytokines and, as a result, to the development of neu-

roinflammation [12, 13, 24, 33,41]. Increase of activity

Fig.  3. Content of mRNAs of the cytokines genes and of the

genes of TLR system in the hippocampus of rat brains during

ethanol abstinence; *p≤0.05 in comparison with the control

group.

EFFECT OF ETHANOL ON INFLAMMATION IN HIPPOCAMPUS 1917

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

of the Hmgb1 and Tlr7 genes leads to activation of the

mechanisms of programmed cell death in the neuro-

nal cell cultures (in  vitro studies), i.e., to manifestation

of the signs of neurodegeneration  [5]. With regard to

the Tlr3 gene, information is available that activation

of the product of expression of this gene, endosomal

protein receptor TLR3, with specific agonists results

in increase of the level of voluntary consumption of

ethanol by animals  [2]. Hence, the observed changes

in the expression of these genes indicates presence of

persistent pathological processes in the hippocampus

of rat brain 7 days after abstinence of ethanol, and

the system of investigated genes participate in their

realization. The obtained data emphasize once more

significance of studies in this research area.

Use of azithromycin for correction of expres-

sion of the genes of cytokines and of the system of

Toll-like receptors under conditions of abstinence

of ethanol. Here we present results of our first ob-

servations aimed at evaluation of expression of the

cytokine genes and of the genes of TLR system in the

rat brain hippocampus under conditions of abstinence

after long-term exposure to ethanol and during phar-

macological correction by azithromycin. AZM has been

recognized as an effective neuroprotector in different

models of pathological states, which decreases the lev-

els of inflammatory factors and slows down the pro-

cess of neuronal cell death [19-22]. Exact mechanism

is not known. In particular, it has been suggested that

the effect could be realized through the protein com-

plex NF-κB  [19-22], which is a key component in the

pathway of transduction of intracellular signals from

TLR[14,15]. We have set a goal to assess possible neu-

roprotective effect of AZM on the investigated system

of the TLR genes in the hippocampus under conditions

of abstinence of long-term exposure to ethanol.

In this study we also obtained the data on ex-

pression of the Tlr3, Hmgb1, and Nfκb1 at the day 7

after abstinence of long-term exposure to ethanol– ex-

pression of the Tlr3 and Hmgb1 genes was increased,

and the level of expression of the Nfκb1 gene did not

change (Fig.4). Treatment with AZM provided correc-

tion of the levels of expression of the Tlr3 and Hmgb1

genes (Fig. 4). With respect to the Hmgb1 gene, all

three used doses of the preparation exhibited positive

effect, while use of the lowest dose of AZM (40mg/kg)

did not affect expression of the Tlr3 gene (Fig.  4).

The AZM preparation did not affect expression of the

Nfκb1 gene(Fig.  4). In addition, we evaluated effects of

AZM on the levels of expression of the genes of proin-

flammatory cytokines Il1β and Ccl2 under conditions

of ethanol abstinence (Fig. 5). Previously, the effects

of AZM on these cytokines were investigated in oth-

er pathological states; it was shown that AZM is ca-

pable of correcting levels of these cytokines [19-22].

In our earlier study we also reported our observa-

tions on expression of the genes of these cytokines

on the day 7 after ethanol abstinence, but the ob-

tained data on their expression were different – in-

crease of expression of the Ccl2 gene was revealed,

and there were no changes in the expression of the

Il1β gene  [36]. These differences could be explained by

the fact that different protocols of modeling long-term

ethanol exposure were used. In the present experi-

ment increase of the level of the Il1β gene expression

was demonstrated, while there were no significant

changes in the expression of the Ccl2 gene (Fig.  5).

Fig. 4. Contents of mRNAs of the genes of TLR system in the

hippocampus of rats under conditions of ethanol abstinence

followed by pharmacological correction with azithromycin;

* p < 0.05 in comparison with the control group; # p < 0.05

in comparison with the group “Abstinence from ethanol

+ water.”

Fig. 5. Contents of mRNAs of the cytokine genes in the

hippocampus of rats under conditions of ethanol absti-

nence followed by pharmacological correction with azith-

romycin; *  p  <  0.05 in comparison with the control group;

#  p  <  0.05 in comparison with the group “Abstinence from

ethanol  +  water.”

AIRAPETOV et al.1918

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

Treatment with AZM allowed to decrease the elevated

level of the Il1β gene expression at all doses of the

preparation used (Fig. 5).

Level of the IL-1β protein under condition of

long-term exposure to ethanol and pharmacologi-

cal correction with azithromycin in the rat hippo-

campus. We concentrated our attention on measuring

of the level of IL-1β protein in the rat hippocampus.

This protein is a key proinflammatory cytokine; level

of this protein increases in the brain tissues during

neuroinflammation development [1, 2, 13].

Role of the IL-1β protein, which mediates devel-

opment of cognitive and emotional disfunctions, has

been investigated in different pathologies. In partic-

ular, in the experiment with mice subjected to psy-

cho-social stress, reduced social interactions and dis-

ruptions of working memory was observed, which

was prevented with knockout of the Il1r1 gene (gene

of the IL-1 protein receptor); and the virus-mediated

selective deletion of the Il1r1 gene in the hippocam-

pus neurons also demonstrated its crucial role in the

stress-induced behavioral dysfunctions. In addition,

it was shown that the stress-induced transport of

monocytes into brain was also blocked by the knock-

out of the Il1r1 gene  [44]. In another study a lentivi-

ral construct was used to induce hyperexpression of

IL-1β in the dorsal hippocampus of rats. As a result,

reduced neurogenesis in the hippocampus was ob-

served together with the decreased level of neurite

branching on neurons  [45]. Data are available indicat-

ing that proinflammatory cytokines suppress long-

term potentiation in the hippocampus, thus trig-

gering changes in the key mechanisms of memory

formation. The researchers revealed using synapto-

somes and neuronal cell cultures that IL-1β directly

suppresses plasticity via neuron-specific mechanisms.

It has also been reported that IL-1β could suppress

long-term potentiation directly in the mouse synapses

[46]. Furthermore, it is known that the hippocampal

neurons express high levels of IL-1R1[46]. These data

indicate involvement of the cytokine in the disruption

of memory formation mechanisms. There is a number

of studies supporting these suggestions, which were

conducted using various animal models [46].

The results of our study showed that the ani-

mals in the group with long-term exposure to etha-

nol and in the group 7 days after ethanol abstinence

have elevated levels of the IL-1β protein (Fig.  6).

Hence, it could be concluded based on the available

information on IL-1β that the observed increase of

the level of this protein in hippocampus (more than

2-fold increase) during the long-term exposure of an

organism to ethanol could be the cause of develop-

ment of emotional and cognitive disorders, as well

as of disruption of the mechanisms of memory for-

mation.

In the experiment we used two doses of azithro-

mycin to test its efficiency with respect to correction

of the IL-1β protein content. Use of azithromycin at

the dose 40  mg/kg did not produce any significant ef-

fect, but using the dose of 160  mg/kg resulted in the

decrease of the level of the protein (to almost con-

trol levels) both in comparison with the group after

ethanol abstinence and with the group of animals

subjected to long-term exposure to ethanol (Fig.  6).

At the same time, analysis at the mRNA level demon-

strated efficiency of both doses of AZM used (40  mg/kg

and 160  mg/kg) (Fig.  5). Hence, the dose of 40  mg/kg,

which is sufficient for reduction of the level of ex-

pression of the Il1β gene, is insufficient to decrease to

the level of the protein product. The observed effect

could be mediated by the effects of azithromycin on

mechanisms of maturation or degradation of the IL-1β

product. The IL-1β protein is formed in the course

of proteolysis from its precursor pro-IL-1β, and, de-

spite the observed decrease of the level of products

of transcription of this gene at the particular time

point, the increased level of the IL-1β protein could

be maintained due to formation of the protein from

the pro-IL-1β molecule in the course of posttransla-

tional mechanisms. Moreover, it is known that deg-

radation of the IL-1β protein also occurs through a

complex pathway, which is mediated, in particular, by

matrix metalloproteinases  [47,  48]. It would be inter-

esting to investigate in future possible contribution

of azithromycin to regulation of the pathways regu-

lating the rate of IL-1β protein degradation. It could

be suggested that the observed persistent increase of

the levels of IL-1β protein with the decreased levels

of the level of expression could be explained by ac-

tivation of the pathways leading to the decrease of

the rate ofprotein degradation. The available dynamic

Fig. 6. Level of IL-1β in the rat hippocampus; *  p  <  0.05 in

comparison with the control group; #p<0.05 in comparison

with the “Abstinence from ethanol + water” group.

EFFECT OF ETHANOL ON INFLAMMATION IN HIPPOCAMPUS 1919

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

correlations also show existence of deviation in time

between the levels of IL-1β mRNA and protein – de-

crease in the levels of mRNA is accompanied with the

increasing trend of the protein level [49].

Summarizing the obtained results about the con-

tent of the key proinflammatory cytokine protein

IL-1β, it could be stated that there are signs of neu-

roinflammation in the hippocampus of the rats sub-

jected to long-term exposure to ethanol and ethanol

abstinence. The tested compound, azithromycin, was

shown to exert positive effect at certain doses with

regard to decrease of the level of neuroinflammatory

mediator IL-1β, which is in agreement with the results

of other studies.

CONCLUSIONS

Modeling of the long-term exposure to moderate

doses of ethanol conducted in this study revealed sev-

eral changes both in biochemical (increase of the lev-

els of ALT and albumin) and clinical (increase of the

level of monocytes and decrease of the level of lym-

phocytes) parameters of the blood, and in the system

of neuroinflammation in the rat brain hippocampus.

We analyzed the levels of activity of the genes of the

Toll-like receptors system, as well as of the molecules

functionally associated with this system including

microRNAs (miRlet7b, miR96, miR155, miR182) and

cytokines. Long-term exposure to ethanol caused in-

crease in the IL-1β mRNA level and the level of IL-1β

cytokine protein, while the levels of Tnfα, Il11, Tlr3,

and Tlr7 mRNAs were found to be decreased. Seven

days after ethanol abstinence the increased levels of

IL-1β mRNA and protein were preserved, as well as

of the Hmgb1 mRNA. On the contrary, the level of

the Tlr3 mRNA was found to be increased after the

ethanol abstinence. Peroral administration of azith-

romycin facilitated correction of some biochemical

changes developed during ethanol abstinence – the

increased levels of Il1β, Tlr3, and Hmgb1 mRNAs were

decreased, and higher doses facilitated decrease of the

increased levels of the IL-1β protein in the rat hippo-

campus. Contents of miRlet7b, miR96, miR155 were

decreased in the hippocamp as a result of long-term

exposure to alcohol. These molecules are functional-

ly associated with the system of TLR, and changes in

their content could reflect or mediate (not known at

the moment) dysfunctions in molecular mechanisms

of functioning of Toll-like receptors.

Investigation of biochemical changes in the rat

hippocampus during modeling of long-term exposure

to ethanol and its abstinence is of significant interest,

because patients with alcohol addiction exhibit disrup-

tion in memory formation and in emotional sphere.

Hippocampus plays an important role in these pro-

cesses, and evaluation of biochemical changes could

help to obtain new information expanding our under-

standing of pathophysiological mechanisms develop-

ing in this brain region during long-term exposure of

an organism to ethanol.

Contributions. All authors contributed signifi-

cantly to the concept development, conducting re-

search, and preparation of the manuscript, all authors

read and approved final version of the manuscript.

M.I.A., S.O.E., S.A.S., and E.R.B. acquiring and analysis

of the data; A.A.L. and P.D.S. development of general

concept of the study, preparation of the final version

of the manuscript.

Funding. This work was financially supported by

the State Budget Project of the Institute of Experimen-

tal Medicine FGWG-2024-0015 “Neurobiological Mech-

anisms of Pathogenesis of Socially Significant Diseas-

es and Posttraumatic Disorders. New Approaches to

Modeling of Pathological Processes and Correction of

Disorders.”

Ethics declarations. All applicable international,

national, and/or institutional guidelines for the care

and use of animals were followed. All procedures in

the animal studies were approved by Ethics Commit-

tee of the Saint-Petersburg State University (protocol

no.131-03-8,29.04.2024). The authors of this work de-

clare that they have no conflict of interest.

REFERENCES

1. Crews, F.T., Lawrimore, C. J., Walter, T. J., and Cole-

man, L. G., Jr. (2017) The role of neuroimmune sig-

naling in alcoholism, Neuropharmacology, 122, 56-73,

https://doi.org/10.1016/j.neuropharm.2017.01.031.

2. Airapetov,M., Eresko,S., Lebedev,A., Bychkov,E., and

Shabanov, P. (2021) The role of Toll-like receptors in

neurobiology of alcoholism, Biosci. Trends, 15, 74-82,

https://doi.org/10.5582/bst.2021.01041.

3. Guerri,C., and Pascual,M. (2019) Impact of neuroim-

mune activation induced by alcohol or drug abuse on

adolescent brain development, Int.J. Dev. Neurosci., 77,

89-98, https://doi.org/10.1016/j.ijdevneu.2018.11.006.

4. Anand, S.K., Ahmad, M.H., Sahu, M.R., Subba,R., and

Mondal, A.C. (2023) Detrimental effects of alcohol-in-

duced inflammation on brain health: from neurogen-

esis to neurodegeneration, Cell. Mol. Neurobiol., 43,

1885-1904, https://doi.org/10.1007/s10571-022-01308-2.

5. Coleman, L.G., Zou,J., and Crews, F.T. (2017) Microg-

lial-derived miRNA let-7 and HMGb1 contribute to

ethanol-induced neurotoxicity via TLR7, J. Neuroin-

flamm., 14, 1-15, https://doi.org/10.1186/s12974-017-

0799-4.

6. Arts, N. J., Walvoort, S. J., and Kessels, R. P. (2017)

Korsakoff’s syndrome: a critical review, Neuropsychi.

AIRAPETOV et al.1920

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

Dis. Treat., 13, 2875-2890, https://doi.org/10.2147/NDT.

S130078.

7. Shabanov, P. D. (1985) Experimental memory disor-

ders and their pharmacological correction [in Rus-

sian], Vestn. Akad. Med. Nauk SSSR, 9, 31-38.

8. Grigorenko, A. Ya., Afanasiev, V. V., and Babakhanyan,

R. V. (2008) Chronic Alcohol Intoxication [in Russian],

Izd-vo R. Aslanova Yuridicheskii Tsentr Press, Saint

Petersburg.

9. Korsakov, S. S., About alcoholic paralysis [in Russian],

Dissertation, Moscow, 1887.

10. Shabanov, P. D., and Borodkin, Yu. S. (1989) Memory

Disorders and their Correction [in Russian], Nauka,

Leningrad.

11. Tsygankov, B. D., and Ovsyannikov, S. A. (2011) Psychi-

atry [in Russian], GEOTAR-Media, Moscow.

12. Crews, F. T., Qin, L., Sheedy, D., Vetreno, R. P., and

Zou, J. (2013) HMGB1/TLR receptor danger signaling

increases brain neuroimmune activation in alcohol

dependence, Biol. Psychiatry, 73, 602-612, https://

doi.org/10.1016/j.biopsych.2012.09.030.

13. Crews, F.T., Walter, T.J., Coleman, L.G., and Vetreno,

R. P. (2017) Toll-like receptor signaling and stages of

addiction, Psychopharmacology (Berl), 234, 1483-1498,

https://doi.org/10.1007/s00213-017-4560-6.

14. Kokryakov, V. N. (2006) Essays on Innate Immunity

[inRussian], Nauka, St. Petersburg.

15. Lebedev, K. A., and Ponyakina, I. D. (2017) Immunol-

ogy of Pattern Recognition Receptors [in Russian],

Lenand, Moscow.

16. Nozdrachev, A. D., Lebedev, A. A., and Shabanov,

P.D. (2000) Organization of reinforcement systems in

brain [in Russian], Vestn. Sankt-Petersburgskogo Univ.

Ser.3. Biol., 4, 62-76.

17. Shabanov, P. D., and Lebedev, A.A. (2001) Reinforce-

ment systems of the brain: localization, neurochem-

ical organization, participation in development of

dependence of psychostimulants [in Russian], Psikho-

farmakol. Biol., 1, 13-26.

18. Becker H. C. (2014) Alcohol and the Nervous Sys-

tem, Handbook of Clinical Neurology, Elsevier, Am-

sterdam.

19. Ramarao, S., Pang, Y., Carter, K., and Bhatt, A. (2022)

Azithromycin protects oligodendrocyte progenitor

cells against lipopolysaccharide-activated microg-

lia-induced damage, Dev. Neurosci., 44, 1-12, https://

doi.org/10.1159/000519874.

20. Lin, S.J., Kuo, M.L., Hsiao, H.S., and Lee, P.T. (2016)

Azithromycin modulates immune response of human

monocyte-derived dendritic cells and CD4

T cells,

Int. Immunopharmacol., 40, 318-326, https://doi.

org/10.1016/j.intimp.2016.09.012.

21. Barks, J. D. E., Liu, Y., Wang, L., Pai, M. P., and Sil-

verstein, F. S. (2019) Repurposing azithromycin for

neonatal neuroprotection, Pediatr. Res., 86, 444-451,

https://doi.org/10.1038/s41390-019-0408-6.

22. Kopper, T. J., and Gensel, J. C. (2021) Continued de-

velopment of azithromycin as a neuroprotective

therapeutic for the treatment of spinal cord inju-

ry and other neurological conditions, Neural Re-

gen. Res., 16, 508-509, https://doi.org/10.4103/1673-

5374.293146.

23. McMahan, R. H., Najarro, K. M., Mullen, J. E., Paul,

M. T., Orlicky, D.J., Hulsebus, H. J., and Kovacs, E. J.

(2021) A novel murine model of multi-day moder-

ate ethanol exposure reveals increased intestinal

dysfunction and liver inflammation with age, Im-

mun. Ageing, 18, 37, https://doi.org/10.1186/s12979-

021-00247-8.

24. Coleman, L. G., Jr., Zou, J., Qin, L., and Crews, F. T.

(2018) HMGB1/IL-1b complexes regulate neuroim-

mune responses in alcoholism, Brain Behav. Immun.,

72, 61-77, https://doi.org/10.1016/j.bbi.2017.10.027.

25. Tucker, A. E., Alicea Pauneto, C.D.M., Barnett, A. M.,

and Coleman, L.G., Jr. (2022) Chronic ethanol causes

persistent increases in Alzheimer’s tau pathology in

female 3xTg-AD mice: a potential role for lysosom-

al impairment, Front. Behav. Neurosci., 16, 886634,

https://doi.org/10.3389/fnbeh.2022.886634.

26. Paxinos G., and Watson C. (2017) The Rat brain in Ste-

reotaxic Coordinates, Academic Press, Sydney.

27. Shi,R., Sun, Y.H., Zhang, X.H., and Chiang, V.L. (2012)

Poly(T) adaptor RT-PCR, Methods Mol. Biol., 822,

53-66, https://doi.org/10.1007/978-1-61779-427-8_4.

28. Burov, Yu. V.,and Vedernikova, N. N. (1985) Neuro-

chemistry and Pharmacology of Alcoholism [in Rus-

sian], Meditsina, Moscow.

29. Vetlugina, T. P., Prokop’eva, V. D., and Bokhan, N. A.

(2023) Biological Bases of Adjuvant Therapy of Alcohol-

ism [in Russian], Tomsk State University Publishing,

Tomsk.

30. Gazatova, N. D., Yurova, K. A., Gavrilov, D. V., and

Litvinova, L. S. (2018) Alcohol and immunity, Geny

Kletki, 13, 47-55.

31. Tsygan, V. N., Akperov, E. K., Vostrikov, V. V., and

Shabanov, P.D. (2007) Immune dysfunctions in drug

addicts and methods of their correction, Rev. Clin.

Pharmacol. Drug Ther., 5, 2-81.

32. Priyanka, S.H., Thushara, A.J., Rauf, A. A., and Indi-

ra,M. (2019) Alcohol induced NLRP3 inflammasome

activation in the brain of rats is attenuated by ATRA

supplementation, Brain Behav. Immun. Health, 2,

100024, https://doi.org/10.1016/j.bbih.2019.100024.

33. Alfonso-Loeches,S., Pascual-Lucas, M., Blanco, A. M.,

Sanchez-Vera, I., and Guerri,C. (2010) Pivotal role of

TLR4 receptors in alcohol-induced neuroinflamma-

tion and brain damage, J. Neurosci., 30, 8285-8295,

https://doi.org/10.1523/JNEUROSCI.0976-10.2010.

34. Ketlinskii, S. A., and Simbirtsev, A. S. (2008) Cytokines

[in Russian], Foliant, St. Petersburg.

35. Airapetov, M., Eresko, S., Ignatova, P., Lebedev, A.,

Bychkov,E., and Shabanov,P. (2022) A brief summary

EFFECT OF ETHANOL ON INFLAMMATION IN HIPPOCAMPUS 1921

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

regarding the roles of interleukin-11 in neurological

diseases, Biosci. Trends, 16, 367-370, https://doi.org/

10.5582/bst.2022.01331.

36. Airapetov, M.I., Eresko, S.O., Kochkin, D.V., Bychkov,

E.R., Lebedev, A.A., and Shabanov, P.D. (2022) Ginse-

nosides affect the system of Toll-like receptors in the

brain of rats under conditions of long-term alcohol

withdrawal, Biomed. Khim., 68, 459-469, https://

doi.org/10.18097/PBMC20226806459.

37. Airapetov, M., Eresko, S., Ignatova, P., Lebedev, A.,

Bychkov, E., and Shabanov, P. (2024) Effect of ri-

fampicin on TLR4-signaling pathways in the nucle-

us accumbens of the rat brain during abstinence of

long-term alcohol treatment, Alcohol Alcohol., 59,

agae016, https://doi.org/10.1093/alcalc/agae016.

38. Airapetov, M.I., Eresko, S.O., Bychkov, E.R., Lebedev,

A. A., and Shabanov, P. D. (2020) Expression of Toll-

like receptors in emotiogenic structures of rat brain

is changed under longterm alcohol consumption and

ethanol withdrawal, Med. Immunol., 22, 77-86, https://

doi.org/10.15789/1563-0625-EOT-1836.

39. Lim, Y., Beane-Ebel, J. E., and Tanaka, Y. (2021) Ex-

ploration of alcohol use disorder-associated brain

miRNA- mRNA regulatory networks, Transl. Psychiatry,

11, 504, https://doi.org/10.1038/s41398-021-01635-w.

40. Lehmann, S. M., Krüger, C., Park, B., Derkow, K.,

Rosenberger, K., Baumgart, J., Trimbuch,T., Eom, G.,

Hinz, M., Kaul,D., Habbel,P., Kälin, R., Franzoni,E.,

Rybak, A., Nguyen, D., Veh, R., Ninnemann, O.,

Peters, O., Nitsch, R., Heppner, F. L., Golenbock, D.,

Schott, E., Ploegh, H. L., Wulczyn, F. G., and

Lehnardt,S. (2012) Anunconventional role for miRNA:

let-7 activates Toll-like receptor 7 and causes neu-

rodegeneration, Nat. Neurosci., 15, 827-835, https://

doi.org/10.1038/nn.3113.

41. Lippai, D., Bala, S., Csak, T., Kurt-Jones, E. A., and

Szabo, G. (2013) Chronic alcohol-induced microRNA-

155 contributes to neuroinflammation in a TLR4-

dependent manner in mice, PLoS One, 8, e70945,

https://doi.org/10.1371/journal.pone.0070945.

42. Ureña-Peralta, J. R., Alfonso-Loeches,S., Cuesta-Diaz,

C.M., García-García,F., and Guerri,C. (2018) Deep se-

quencing and miRNA profiles in alcohol-induced neu-

roinflammation and the TLR4 response in mice cere-

bral cortex, Sci. Rep., 8, 15913, https://doi.org/10.1038/

s41598-018-34277-y.

43. Ureña-Peralta, J. R., Pérez-Moraga, R., García-

García, F., and Guerri, C. (2020) Lack of TLR4 modi-

fies the miRNAs profile and attenuates inflammatory

signaling pathways, PLoS One, 15, 0237066, https://

doi.org/10.1371/journal.pone.0237066.

44. DiSabato, D.J., Nemeth, D. P., Liu, X., Witcher, K.G.,

O’Neil, S.M., Oliver,B., Bray, C.E., Sheridan, J.F., God-

bout, J.P., and Quan,N. (2021) Interleukin-1 receptor

on hippocampal neurons drives social withdraw-

al and cognitive deficits after chronic social stress,

Mol. Psychiatry, 26, 4770-4782, https://doi.org/10.1038/

s41380-020-0788-3.

45. Pawley, L.C., Hueston, C.M., O’Leary, J.D., Kozareva,

D.A., Cryan, J.F., O’Leary, O.F., and Nolan, Y.M. (2020)

Chronic intrahippocampal interleukin-1b overexpres-

sion in adolescence impairs hippocampal neurogen-

esis but not neurogenesis-associated cognition, Brain

Behav. Immun., 83, 172-179, https://doi.org/10.1016/

j.bbi.2019.10.007.

46. Prieto, G.A., Tong,L., Smith, E.D., and Cotman, C.W.

(2019) TNFα and IL-1b but not IL-18 suppresses hippo-

campal long-term potentiation directly at the synapse,

Neurochem. Res., 44, 49-60, https://doi.org/10.1007/

s11064-018-2517-8.

47. Vijayaraj, S. L., Feltham, R., Rashidi, M., Frank, D.,

Liu, Z., Simpson, D. S., Ebert, G., Vince, A., Herold,

M. J., Kueh, A., Pearson, J. S., Dagley, L. F., Murphy,

J.M., Webb, A.I., Lawlor, K.E., and Vince, J.E. (2021)

The ubiquitylation of IL-1b limits its cleavage by

caspase-1 and targets it for proteasomal degrada-

tion, Nat. Commun., 12, 2713, https://doi.org/10.1038/

s41467-021-22979-3.

48. Tong,Z., Yang, X., and Li,J. (2022) Research progress

on the mechanism of interleukin-1b on epiphyseal

plate chondrocytes, Eur.J. Med. Res., 27, 313, https://

doi.org/10.1186/s40001-022-00893-8.

49. Kalb, D.M., Adikari, S.H., Hong-Geller,E., and Werner,

J.H. (2019) Single-cell correlations of mRNA and pro-

tein content in a human monocytic cell line after LPS

stimulation, PLoS One, 14, e0215602, https://doi.org/

10.1371/journal.pone.

Publisher’s Note. Pleiades Publishing remains

neutral with regard to jurisdictional claims in published

maps and institutional affiliations. AI tools may have

been used in the translation or editing of this article.