Article

ISSN 0006-2979, Biochemistry (Moscow), 2024, Vol. 89, No. 11, pp. 1950-1960 © Pleiades Publishing, Ltd., 2024.

1950

Prenatal Hypoxia Predisposes to Impaired Expression

of the chrna4 and chrna7 Genes in Adult Rats

without Affecting Acetylcholine Metabolism

during Embryonic Development

Oleg V. Vetrovoy

1,a

*, Sofiia S. Potapova

, Viktor A. Stratilov

and Ekaterina I. Tyulkova

Laboratory of Regulation of Brain Neuronal Functions, Pavlov Institute of Physiology,

Russian Academy of Sciences, 199034 Saint Petersburg, Russia

e-mail: vov210292@yandex.ru

Received April 18, 2024

Revised May 28, 2024

Accepted June 3, 2024

Abstract— Previous studies have shown that the combined effect of fetal hypoxia and maternal stress hormones

predetermines tendency to nicotine addiction in adulthood. This study in rats aimed to investigate the effect of

prenatal severe hypoxia (PSH) on acetylcholine metabolism in the developing brain, as well as on expression

of acetylcholine receptors chrna4 and chrna7 in both the developing brain and adult brain structures following

nicotine consumption. In the developing brain of PSH rats, no changes were found in the activity of choline

acetyltransferase (ChAT) and acetylcholinesterase (AChE) or disturbances in the acetylcholine levels. However,

decreased chrna4 expression was detected on the day 15 of pregnancy, while elevation in the chrna7 expression

was observed on the days 15 and 16 of embryogenesis. In adulthood, the consequences of PSH were mani-

fested as decreased expression of chrna4 in the medial prefrontal cortex (PFC), nucleus accumbens (NAacc),

and hypothalamus (HT), decreased expression of chrna7 in the PFC and hippocampus (HPC). Whereas, nicotine

consumption did not decrease the expression levels of chrna4 and chrna7 compared to the control group in

the adult PSH rats. Thus, prenatal hypoxia predisposes to impaired expression of the chrna4 and chrna7 genes

in adult rats without affecting acetylcholine metabolism during embryonic development.

DOI: 10.1134/S0006297924110099

Keywords: rat, brain development, prenatal hypoxia, acetylcholine metabolism, chrna4, chrna7

Abbreviations: AMG, amygdala; AChE,acetylcholinesterase; ChAT,choline acetyltransferase; chrna4,acetylcholine receptor

subunit alpha-4 mRNA; chrna7 (CHRNA7), acetylcholine receptor subunit alpha-7 mRNA (protein); HPC, hippocampus;

HT,hypothalamus; NAcc,nucleus accumbens; PFC,medial prefrontal cortex; PSH,prenatal severe hypoxia; PVN,thalamic

paraventricular nucleus; VTA, ventral tegmental area.

* To whom correspondence should be addressed.

INTRODUCTION

Nicotine addiction is a serious public threat, with

a death toll of up to 8 million people every year [1].

In contemporary understanding, alongside with the

genetic predisposition to nicotine addiction [2,3], epi-

genetic changes influenced by environmental factors,

which occur especially during embryonic brain devel-

opment, are also of great importance [4,  5]. Thus, ex-

posure to environmental stressors during the prenatal

period, mediated by the maternal endocrine system or

changes in fetal oxygen availability, increases the risk

of substance use disorders [6,  7], especially nicotine

dependence, in offsprings [8,  9].

Fetal hypoxia, often accompanied by the response

of the mother’s glucocorticoid system to impaired ox-

ygen delivery, is one of the most significant factors

that predetermines disturbances in the development

PRENATAL HYPOXIA 1951

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

of the mesolimbic system of the brain. This condition

leads to heightened nicotine consumption in an adult

offspring  [9]. In particular, our previous studies on

rats have highlighted that the increased risk of nico-

tine addiction in adult rats might be associated with

the episodes of severe hypoxia during 14th-16th days

of embryogenesis [10,11], equivalent to 5th-7th weeks

of pregnancy in humans  [12]. During this period, do-

paminergic neurons of the ventral tegmental area

(VTA) complete their axonal guidance to the nucleus

accumbens (NAcc)  [13], while hippocampus and oth-

er cortical structures innervating the NAcc begin to

form  [14]. In our previous investigation, we addition-

ally compared the effects of fetal intrauterine isch-

emia  [11,  15] and prenatal hypoxia induced within a

pressure chamber, combined with the maternal stress

response. We found that the key role in predisposing

individuals to nicotine addiction lies not solely in hy-

poxia itself, but also in the excessive supply of gluco-

corticoids to the developing brain [11]. This led to the

aberrant expression profile of glucocorticoid receptors

in the extrahypothalamic brain structures, causing dis-

ruption of the circadian dynamics of glucocorticoids,

impaired glucocorticoid-dependent expression, and,

consequently, resulting in malfunctioning of the glu-

cocorticoid-dependent processes throughout later life

[16-18]. Hypoxia and stress-related processes could

influence maturation of the cholinergic mediator sys-

tem, both by altering expression of the individual

elements [19] and by requiring a sufficient level of

aerobic oxidative metabolism for the effective acetyl-

choline synthesis [20-22].

Primary mechanisms underlying impact of pre-

natal hypoxia and maternal glucocorticoid stress

hormones on fetal brain development, crucial for

nicotine addiction, still remain unclear. Therefore, in

this study, we studied activity dynamics of the key

enzymes involved in acetylcholine synthesis and deg-

radation, namely choline acetyltransferase (ChAT) and

acetylcholinesterase (AChE), as well as fluctuations in

acetylcholine concentration over the third week of

embryonic development (e15, e16, e17, e20), as well

as on the day  1 after their birth (p1) in the control

rats and the rats exposed to prenatal severe hypox-

ia (PSH). Given the potential for disruptions in the

expression of acetylcholine receptors, we also inves-

tigated transcription dynamics of acetylcholine recep-

tor subunits alpha-4 (chrna4) and alpha-7 (chrna7) in

both developing and adult brains, as well as under

the influence of prenatal hypoxia. Chronic nicotine

dependence originates from the reduced transcription

of acetylcholine receptors due to external nicotine in-

take. We have previously shown that the adult PSH

rats exhibit an increased propensity to consume nic-

otine under free-choice conditions [10], while chronic

nicotine intake through osmotic pumps causes more

pronounced behavioral signs of nicotine dependence

in these rats compared to the control animals [10,11].

In this study, we also used osmotic minipumps to pro-

vide a continuous supply of nicotine over two weeks,

comparing effects of nicotine on the chrna4 and

chrna7 transcription in the brain structures of adult

rats in the control and PSH groups.

MATERIALS AND METHODS

Animals. The study was carried out using animals

from the CCU “Biocollection of laboratory mammals

of different taxonomic affiliation” of the Pavlov Insti-

tute of Physiology of the Russian Academy of Sciences.

Adult pregnant female Wistar rats, aged 12-13 weeks

and weighing 220-250  g, along with their embryonic

(e15, e16, e17, e20), newborn (p1) progeny without sex

definition and adult male offspring, aged 12 weeks

and weighing 320-350  g, were utilized. All experimen-

tal procedures were performed in compliance with

The Guidelines for Reporting Animal Research  [23]

and were approved by the Ethical Committee for the

Use of Animal Subjects at the Pavlov Institute of Phys-

iology (protocol no. 08/02 of 02.08.2022).

Prenatal severe hypoxia. Model of prenatal se-

vere hypoxia (PSH) described in our previous studies

was used as a reliable model of fetal hypoxia [10, 11,

16-18]. To model PSH, we used a flow-type hypobaric

chamber at a temperature of 20°C to 25°C in which

atmospheric pressure was gradually reduced to 180

Torr reaching 5% of oxygen content (equivalent to

11,000  m above sea level) during 20  min. After 3  h of

treatment the oxygen content was returned to normal

within 20  min. Pregnant dams were treated under

such conditions for 3 consecutive days (14th, 15th,

and 16th days of pregnancy) with an interval of 24  h

between the sessions. Mortality rate in the hypobaric

chamber was around 15%. Intact control females were

also placed in the hypobaric chamber for 3  h on the

14th, 15th, and 16th days of pregnancy without being

subjected to hypoxic or hypobaric exposure. Gestation

period was 22-23 days.

Colorimetric methods. To collect brain samples

for colorimetric analysis, tissues from embryonic (e15,

e16, e17, e20) and newborn (p1) brains of both con-

trol and PSH rats were dissected and frozen in liquid

nitrogen. Each rat group consisted of randomly select-

ed embryos or pups from different dams to minimize

litter bias.

Measurement of choline acetyltransferase activity.

ChAT activity was analyzed using a colorimetric assay

kit (E-BC-K125-M; Elabscience, USA). Dissected brain

samples were washed and homogenized in PBS (0.01  M,

pH  7.4) at 4°C and centrifuged at 10,000g for 10  min to

isolate cytosolic proteins. The assay procedures were

VETROVOY et al.1952

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

conducted following the manufacturer’s protocol, and

absorbance was measured at 324  nm using a micro-

plate reader (CLARIOstar PLUS, BMG Labtech, Germa-

ny). Amount of coenzyme A generated during the re-

action was determined using a standard curve. ChAT

activity was calculated as nanomoles of coenzyme A

generated per minute per milligram of total protein.

Both here and in the other biochemical tests below,

total protein in the samples was measured using a

Pierce Rapid Gold Bicinchoninic Acid Protein Assay

Kit (Thermo Fisher Scientific, USA) according to the

manufacturer’s protocol.

Measurement of acetylcholinesterase activity.

AChE activity was analyzed using a colorimetric as-

say kit (E-BC-K052-S; Elabscience). Dissected brain

samples were washed and homogenized in 0.9%  NaCl

at 4°C. The assay procedures were conducted fol-

lowing the manufacturer’s protocol, and absorbance

was measured at 520 nm using a microplate reader

(CLARIOstar PLUS, BMG Labtech). Amount of acetyl-

choline remaining after the reaction was determined

using a standard curve. AChE activity was calculated

as nanomoles of acetylcholine hydrolyzed per minute

per milligram of total protein.

Measurement of acetylcholine levels. Acetylcholine

levels were analyzed using a colorimetric ELISA kit

(E-EL-0081; Elabscience). Dissected brain samples were

washed and homogenized in PBS (0.01  M, pH  7.4) at

4°C and centrifuged at 5000g for 10  min to isolate su-

pernatant containing acetylcholine. The assay proce-

dures were conducted following the manufacturer’s

protocol, and absorbance was measured at 450  nm

using a microplate reader (CLARIOstar PLUS, BMG

Labtech). Amount of acetylcholine was quantified us-

ing a standard curve, calculated and expressed as pi-

comoles per milligram of total protein.

Chronic treatment with nicotine in adult rats.

Rat pups were weaned at 30 days of age, a time when

dams spent no more than 2  h nursing [24]. This post-

partum day aligns with our prior studies on prenatal

pathologies, mitigating the stress typically associated

with weaning. After weaning, the rats were housed

in cages 60  ×  30  ×  20  cm in size, with 5-6 animals in

each. Each rat group consisted of randomly selected

rats born from different dams to minimize litter bias.

The rats received food and water ad  libitum and were

kept on a 12  :  12-h dark-light cycle at room tempera-

ture with a constant humidity of approximately 60%.

For the experimental procedures, we used adult male

offspring with active spermatogenesis from the con-

trol and PSH groups at the age of 3 months. On day1,

osmotic minipumps (2002W, RWD Systems, China)

were subcutaneously implanted into the rats under

isoflurane anesthesia and a nicotine tartrate solution

was pumped at a flow rate of 0.5  μl/h. Nicotine con-

centration in the pumps was adjusted for the differ-

ences in rat body weight, resulting in a continuous

subcutaneous infusion of nicotine tartrate at a rate

of 9  mg/kg per day. In the nicotine-naive control and

PSH rats minipumps were filled with saline (vehicle).

After two weeks of nicotine or vehicle consumption,

the rats were scarified by guillotine, and samples

of brain structures were collected for PCR analysis.

Quantitative RT PCR. Total RNA from embryon-

ic (e15, e16, e17, e20) and newborn (p1) brain sam-

ples of the control and PSH rats, as well as from the

samples of hippocampus (HPC), medial prefrontal

cortex (PFC), amygdala (AMG), nucleus accumbens

(NAcc), thalamic paraventricular nucleus (PVN), hypo-

thalamus(HT), and VTA of adult rats (two weeks after

nicotine or vehicle consumption) was isolated using an

ExtractRNA Kit (BC032, Evrogen, Russia) and purified

using DNAseI (SB-G3342, Servicebio, China) according

to the manufacturers’ instructions. Quality and concen-

tration of total RNA were determined by measuring

optical density at 260  nm and 280  nm using a mi-

croplate reader (CLARIOstar PLUS, BMG Labtech).

cDNA templates were synthesized from 2 μg of total

RNA using a MMLV Reverse Transcription Kit (SK021,

Evrogen). Quantitative reverse transcription poly-

merase chain reaction (RT PCR) was carried out with

a qPCRmix-HS SYBR+LowROX kit (Evrogen) using a

Gentier 96E Thermal Cycler (Tianlong, China). Expres-

sion levels of the target acetylcholine receptor sub-

unit alpha-4 (chrna4) and acetylcholine receptor sub-

unit alpha-7 (chrna7) genes were estimated using the

ΔΔCt method with normalization to β-tubulin mRNA

content as a reference gene. We used the following

primer sequences: chrna4, forward: GGTGAAGGAGG

ACTGGAA, reverse: AAGGCAGACAATGATGAACA (an-

nealing temperature 58°C, 78  bp product); chrna7,

forward: CTCTTGGAATAACTGTCTT, reverse: CGAAGT

ATTGTGCTATCA (annealing temperature 58°C, 105  bp

product); β-tubulin, forward: TAGAGGAGATGCTACTTA,

reverse: AATGGTGATAATACTGTTAA (annealing tem-

perature 58°C, 147  bp product).

Western blotting. To confirm the effect of chang-

es in chrna7 mRNA expression on the CHRNA7 protein

levels in the brain structures of adult control and PSH

rats we used Western blotting. To obtain total protein

extracts for Western blotting, samples of HPC, PFC,

AMG, NAcc, PVN, HT, and VTA were homogenized in

a 50  mM Tris-HCl (pH  8.0) containing 150  mM NaCl,

1%  Triton X100 and a cocktail of protease and phos-

phatase inhibitors (SB-G2006, SB-G2007, Servicebio).

Homogenates were incubated on a shaker for 30min

at 4°C, centrifuged for 10  min at 14,000g, and super-

natants were collected. The samples containing equal

amounts of total protein were boiled for 10  min at

70°C with a 3x Laemmli buffer.

Proteins were separated by sodium dodecyl sul-

fate-polyacrylamide gel electrophoresis (SDS-PAGE)

PRENATAL HYPOXIA 1953

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

and next transferred to PVDF membranes (Thermo

Scientific, USA). After blocking for 1  h in PBS con-

taining 5% skim milk, the membranes were incubat-

ed in PBS with rabbit anti-CHRNA7 (1  :  2000, DF13247,

Affinity Biosciences, USA) and anti-β-Tubulin (1  :  5000,

ab179513, Abcam, UK) primary antibodies for 2  h

at room temperature.

The membranes were then washed thrice with

PBST (PBS with 0.1%  Tween  20) and incubated in

PBS with HRP-conjugated anti-rabbit secondary an-

tibodies (1  :  5000, E-AB-1003, Elabscience) for 1  h at

room temperature. The membranes were next washed

twice with PBST. Immunoreactive protein bands were

visualized using a Clarity ECL chemiluminescence

kit (Bio-Rad, USA) with a ChemiScope 6000 Imaging

System (Clinx Science Instruments, China). Protein

levels were quantified using ImageJ software (NIH,

USA) and normalized to β-Tubulin. Full images of the

Western blots are presented in the Online Resource 1

(Fig. S1).

Statistical analysis. Statistical analysis was

performed using Prism  10 (GraphPad, Inc.). All sam-

ples were assessed for normal distribution using the

Shapiro–Wilk test (p  >  0.05) and QQ-plot. One- or two-

way ANOVA was used as a parametric test. Post  hoc

comparisons were performed using Tukey’s honest sig-

nificance test. Statistical significance was set at p  <  0.05.

The results are expressed as a mean  ±  standard error

of the mean (SEM). For RT PCR and Western blotting,

the mean and SEM were recalculated as% of a respec-

tive age control, taken as 100%.

RESULTS

Impact of prenatal hypoxia on acetylcholine

metabolism in the rat brain during prenatal and

early postnatal development. To investigate the effect

of prenatal hypoxia on acetylcholine metabolism, we

measured activity of choline acetyltransferase (ChAT),

an enzyme that synthesizes this neurotransmitter, as

well as activity of acetylcholinesterase (AChE), an en-

zyme that degrades acetylcholine, in the developing

brain of rat embryos during the third week of preg-

nancy (e15, e16, e17, e20) and in the newborn rats

(p1) (Fig. 1, a, b). We did not detect any changes in

the activity of these enzymes in the brain of PSH rats

compared to the controls. In the brain of PSH rats, we

observed no alterations in the activity of ChAT and

AChE. Likewise, there were no significant changes in

the concentration of acetylcholine across all periods

studied (Fig. 1c).

Impact of prenatal hypoxia on expression of

acetylcholine receptors mRNA in the rat brain

during prenatal and early postnatal development.

To evaluate the effect of prenatal hypoxia on the re-

ceptor part of acetylcholine neurotransmitter system,

we measured relative content of the acetylcholine

receptor subunit alpha-4 (chrna4) and acetylcholine

receptor subunit alpha-7 (chrna7) mRNA in the de-

veloping brain during the third week of pregnancy

(e15, e16, e17, e20) and in the brains of newborn

rats (p1) (Fig. 2, a, b). Decrease in the relative

amount of chrna4 mRNA was found in the rat brain

one day after the first PSH session (Fig. 2a, e15,

ANOVA  F  (1,  9) = 10.2212, p = 0.0127; control vs. PSH,

p = 0.0126685, Tukey’s HST). During further prenatal

development and in the newborn PSH rats, no signif-

icant changes in the chrna4 expression in the brain

Fig. 1. Effect of PSH on ChAT (a) and AChE (b) activity and

acetylcholine(c) levels in the rat brain during prenatal (em-

bryonic days e15, e16, e17, e20) and early postnatal (postna-

tal dayp1) development, detected by colorimetric tests. n=5.

VETROVOY et al.1954

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

Fig. 2. Effect of PSH on chrna4 (a) and chrna7 (b) mRNA

expression levels in the rat brain during prenatal (embryonic

days e15, e16, e17, e20) and early postnatal (postnatal day p1)

development, detected by RT PCR. *  Significant differences

vs. relative control, p < 0.05 (one-way ANOVA, Tukey HST).

n=5.

were detected. In addition, we found increase in the

relative amount of the chrna7 mRNA both 24  h after

the first PSH session (Fig. 2b, e15, ANOVA  F  (1,  9)  =

=  7.2211, p  =  0.0276; control vs. PSH, p = 0.0276166,

Tukey’s HST) and one day after the second PSH session

(Fig.2b, e16, ANOVA F (1,9)=6.6590, p =0.0326; con-

trol vs. PSH, p = 0.0325905, Tukey’s HST). Throughout

further prenatal development and in the newborn PSH

rats, no significant changes in the chrna7 expression

in the brain were detected. Thus, despite the lack of

effect on acetylcholine metabolism, prenatal hypoxia

causes changes in the expression of acetylcholine re-

ceptors in the developing brain.

Impact of prenatal hypoxia on the expression

of acetylcholine receptors mRNA in the rat brain

structures in normal adult animals and in animals

exposed to nicotine. To study long-term consequences

of prenatal hypoxia on the expression of acetylcholine

receptors in the rat brain, we measured relative con-

tent of chrna4 and chrna7 mRNA in the limbic system

structures (HPC, PFC, AMG, NAcc, PVN, HT, VTA) of the

adult (3-month-old) control and PSH rats, both before

and after two weeks of stable nicotine consumption

via osmotic pumps.

When assessing relative amount of mRNA, sig-

nificant decreases in the expression of chrna4 gene

caused by PSH was observed in the PFC (Fig. 3b,

two-way ANOVA Group × Nicotine  F  (1,  16)  =  9.872,

p  =  0.0063; control vs. PSH, p  =  0.0399817, Tukey’s HST),

NAcc (Fig.  3d, ANOVA Group × Nicotine  F  (1,  16)  =

=  5.644, p  =  0.0304; control vs. PSH, p  =  0.0190, Tukey’s

HST), and HT (Fig. 3f, two-way ANOVA Group × Nic-

otine  F  (1,  16)  =  9.673, p  =  0.0067; control vs. PSH, p =

=  0.0061796, Tukey’s HST), with no effect on HPC

(Fig.3a), AMG (Fig.3c), PVN (Fig.3e), and VTA (Fig.3g).

Moreover, following two weeks of nicotine consump-

tion, the amount of chrna4 mRNA in the brains of

control rats significantly decreased to the values

comparable to those of the PSH rats in HPC (Fig.  3a,

two-way ANOVA Nicotine  F  (1,  17)  =  9.989, p  =  0.0057;

control vs. control  +  nicotine, p  =  0.0057263, Tukey’s

HST), PFC (Fig.  3b, two-way ANOVA Group × Nico-

tine  F  (1,  16)  =  9.872, p  =  0.0063, p  =  0.0234; control vs.

control  +  nicotine, p  =  0.0022758, Tukey’s HST), NAcc

(Fig. 3d, two-way ANOVA Group × Nicotine  F  (1,  16)  =

=  5.644, p  =  0.0304; control vs. control  +  nicotine, p =

=  0.0421275, Tukey’s HST) and HT (Fig.  3f, two-way

ANOVA Group × Nicotine  F  (1,  16)  =  9.673, p  =  0.0067;

control vs. control  +  nicotine, p  =  0.0157127, Tukey’s

HST). In contrast, nicotine consumption by the PSH

rats did not induce alterations in the chrna4 mRNA

content across all brain structures when compared to

the intact PSH rats (Fig. 3).

When assessing relative amount of chrna7 mRNA

in the brains of adult rats, PSH was found to cause

significant decrease of the gene expression in the HPC

(Fig. 3h, two-way ANOVA Group × Nicotine  F  (1,  16)  =

=  7.945, p  =  0.0124; control vs. PSH, p  =  0.038 Tukey’s

HST) and PFC (Fig.  3i, two-way ANOVA Group × Nic-

otine  F  (1,  16)  =  9.55, p  =  0.00702; control vs. PSH, p =

=  0.0157, Tukey’s HST), while leaving the AMG (Fig.  3j),

PVN (Fig.  3k), NAcc (Fig.  3l), HT (Fig.  3m) and VTA

(Fig.  3n) unaffected. Association between the changes

in chrna7 mRNA levels and the patterns of CHRNA7

protein expression in the brain structures of adult

control and PSH rats was subsequently tested by West-

ern blotting (Fig.  4). Similar to the changes in rela-

tive mRNA levels, PSH was found to cause decrease

in the CHRNA7 protein levels in the HPC (Fig.  4a,

ANOVA  F  (1,  9)  =  5.6864, p  =  0.0442; control vs. PSH,

p =  0.0442243, Tukey’s HST) and PFC (Fig.  4b, ANOVA

F  (1,  9)  =  11.9926, p  =  0.0085; control vs. PSH, p =

=  0.0085305, Tukey’s HST), but not in AMG (Fig.  4c), PVN

(Fig.  4d), NAcc (Fig.  4e), HT (Fig.  4f) and VTA (Fig.  4g).

Furthermore, following two weeks of nicotine

consumption, the amount of chrna7 mRNA in the

brains of control rats significantly decreased to the

levels observed in the HPC of the PSH rats (Fig.  3h,

two-way ANOVA Group × Nicotine  F  (1,  16)  =  7.945,

p  =  0.0124; control vs. control + nicotine, p  =  0.0103,

PRENATAL HYPOXIA 1955

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

Fig. 3. Effects of PSH and nicotine consumption on chrna4 (a-g) and chrna7 (h-n) mRNA expression levels in the HPC(a,h),

PFC (b, i), AMG(c, j), NAcc (d, k), PVN(e, l), HT (f,m), VTA (g,n) of adult rats, detected by RT PCR. *  Significant differences

vs. control, p < 0.05 (two-way ANOVA, Tukey HST). n=5.

Tukey’s HST) and PFC (Fig.  3i, two-way ANOVA

Group × Nicotine  F  (1,  16)  =  9.55, p  = 0.00702; control

vs. control+ nicotine, p  =  0.0156, Tukey’s HST). Mean-

while, in the brains of PSH rats, nicotine consumption

did not cause changes in the chrna7 mRNA levels com-

pared to the intact PSH rats.

VETROVOY et al.1956

BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024

Fig. 4. Effects of PSH on CHRNA7 protein expression levels in the HPC(a), PFC(b), AMG(c), NAcc(d), PVN(e), HT(f), VTA(g)

of adult rats, detected by western blotting. *  Significant differences vs. control, p<0.05 (one-way ANOVA, Tukey HST). n=5.

DISCUSSION

Environmental factors exert significant impacts

on the developing organism. Conditions for forma-

tion of individual organs and tissues of the fetus

predetermine their subsequent life activities [25-27].

During a normal pregnancy, there is high efficiency

in providing energy substrates essential for intensive

processes of cell proliferation, migration, and estab-

lishment of connections between the brain cells [28].

Moreover, steroid hormone supply is restricted until

the later stages of pregnancy, when glucocorticoids

are involved in the processes such as terminal differ-

entiation of neuronal cells and lung maturation [29-

32]. Restriction of oxygen supply to an embryo causes

significant metabolic disorder, resulting in the devel-

opmental deceleration [25-27, 33, 34], whereas exces-

sive infiltration of glucocorticoids may disrupt forma-

tion of an adequate tissue-specific expression profile,

which could remain throughout the life at epigenetic

level [16, 17, 35, 36].

Hypoxia is inevitably accompanied by the shift

of cellular metabolism towards anaerobic metabolism

regulated by hypoxia-inducible factors (HIF) [37], and

decline in aerobic energy metabolism, resulting in the

reduced production of ATP [38,  39], which is required,

in particular, for the synthesis of acetylcholine  [40].

However, severity of the effects of hypoxia and ma-

ternal stress can vary significantly depending on the

time of the developing brain exposure [12]. Thus, when

prenatal hypoxia was induced on the days 14-16 of

embryonic development, no significant changes were

observed in the activity of both choline acetyltransfer-

ase and acetylcholinesterase. Consequently, this lack

of change did not affect concentration of acetylcholine

in the developing embryonic and early postnatal rat

brain. This finding contrasts with the prior studies,

including our own, which demonstrated intensifica-

tion of the hypoxia-dependent signaling during both

embryogenesis and the postnatal period [26, 41-45].

At the same time, at the early stages of hypoxic ep-

isodes, decrease in the transcription of chrna4 (e15)

and, potentially, glucocorticoid-dependent increase in

the transcription o