Article

ISSN 0006-2979, Biochemistry (Moscow), 2025, Vol. 90, No. 12, pp. 1970-1984 © The Author(s) 2025. This article is an open access publication.

Russian Text © The Author(s), 2025, published in Biokhimiya, 2025, Vol. 90, No. 12, pp. 2077-2092.

1970

Progeroid Syndrome with Signs

of Autophagy Dysfunction

in the Naked Mole Rat (Heterocephalus glaber)

Vasiliy N. Manskikh

1,a

*, Eugene V. Sheval

, Maria V. Marey

Olga A. Averina

, and Mikhail Yu. Vyssokikh

1,2

A. N. Belozersky Research Institute of Physico-Chemical Biology, Lomonosov Moscow State University,

119992 Moscow, Russia

V. I. Kulakov National Medical Research Center for Obstetrics, Gynecology, and Perinatology,

Ministry of Health of the Russian Federation, 117997 Moscow, Russia

e-mail: manskikh@mail.ru

Received July 1, 2025

Revised November 27, 2025

Accepted November 27, 2025

Abstract— The naked mole rat is considered a unique non-aging mammalian species and is widely used in

laboratories to study the biology of longevity. Previously, our group was the first to describe a new fatal

disease in the naked mole rat, termed “idiopathic cachexia.” A detailed study of pathological changes in the

organs of affected animals, combined with the data on gene expression changes, allows us to interpret this

disease as a highly specific variant of accelerated aging (progeroid syndrome or progeria) in these animals.

Symptoms of the disease include cachexia, cataracts, lipofuscinosis, and appearance of amyloid bodies (corpora

amylacea) in the brain, severe degeneration of cardiomyocytes, fatty degeneration, and generalized lipofus-

cinosis of the liver and kidneys, with signs of autophagy dysfunction in these organs. Further research is

needed to elucidate the mechanism of this disease in animals with negligible aging, such as naked mole rats,

which may provide insights into the mechanisms of aging and lifespan extension.

DOI: 10.1134/S0006297925601960

Keywords: naked mole rat, autophagy, progeria, aging, lipofuscin

* To whom correspondence should be addressed.

INTRODUCTION

Since the publication of Buffenstein etal. [1], the

naked mole rat has been regarded as a mammalian

species with negligible or no aging. Indeed, this ani-

mal exhibits numerous unique features, including an

unusually long lifespan for a rodent (up to 40 years)

[1, 2], no increase in mortality risk with age [1-3],

resistance to spontaneous and induced carcinogenesis

[4-8], many neotenic traits [3], and other physiological

characteristics [9, 10]. Without delving into the debate

about how much the focus on studying these features

is tied to the fascination with a new research sub-

ject, and why similar traits are not studied in other

animals (for example, resistance to tumor growth in

guinea pigs [11]), it must be acknowledged that the

naked mole rat is truly a unique model organism for

studying gerontology. While physiology of this ani-

mal has been extensively studied, its pathology has

received relatively little attention – only a few studies

have broadly described the spontaneous pathology of

the naked mole rat [6, 10, 12-15]. Although several

potentially age-related diseases have been identified

(progressive rodent nephropathy [13, 16], malignant

tumors [6, 14], skin and organ mineralization [12]),

in general, the presence of aging-related pathologies

in this animal remains poorly studied and rarely

debated.

Previously, our research group described a new

disease in the naked mole rats, characterized by a

sharp decline in body weight, a distinctive exter-

nal appearance, ascites, neurological symptoms, and

PROGEROID SYNDROME 1971

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

death of the relatively young individuals (2-6 years

old). This disease was termed “idiopathic cachexia”

[17]. A detailed pathological examination of the de-

ceased and euthanized animals with signs of this

disease revealed a range of morphological and histo-

chemical changes traditionally associated with aging

at the cellular and tissue levels. This article describes

these changes. Since the preliminary data on the mi-

croRNA spectrum in these animals indicated altered

regulation of gene expression related to autophagy

[17], and based on the available morphological data

(lipofuscin accumulation), this study investigated

markers of this process.

MATERIALS AND METHODS

Animal care. A colony of naked mole rats at

the Belozersky Institute of Physico-Chemical Biology,

Lomonosov Moscow State University (comprising 54

individuals), was obtained from a core group import-

ed from the Leibniz Institute for Zoo and Wildlife

Research (IZW) in Berlin, Germany. All animals de-

scribed in this study were from the same colony and

were housed together in a system of cylindrical plas-

tic containers connected by plastic tubes, at 27  ±  1°C

and 50  ±  10% humidity, with a 12/12-hour light/dark

cycle (10:00-22:00 light) and atmospheric ventilation.

The diet consisted of apples, sweet potatoes, carrots,

and grains, provided daily. To enrich the habitat, a

rectangular container with high-density clay, mim-

icking the natural soil of their habitat, was installed.

Six months after the container was introduced, some

worker animals began to lose weight rapidly. The

container was immediately removed after signs of

cachexia were detected in 9 out of 54 animals (3 fe-

males and 6 males, aged 2-6 years). The animals were

then observed for 3 years. To monitor their condi-

tion, the body mass index was measured every 4-5

months in both cachexic and healthy control animals

of the same age (n  =  9; 4 females and 5 males) from

the same colony. Euthanasia was performed by de-

capitation after anesthesia with isoflurane inhalation

(5% at 0.4  L/min flow; Laboratorios Karizoo S.A.,

Spain) using an R500 system (RWD, China).

Necropsy and histopathological examination.

Spontaneously deceased (n  =  2) and euthanized (n = 7)

animals with signs of cachexia underwent patholog-

ical examination. The criteria for euthanasia were

as follows: 15% reduction in body weight and visual

signs of cachexia, ascites, and neurological symptoms

(stupor and ataxia). Additionally, 7 healthy control

animals without signs of cachexia, kept under the

same conditions, were euthanized and examined. All

animals underwent thorough macroscopic examina-

tion. Samples were taken from the heart, lungs, liver,

kidneys, pancreas, mesenteric lymph nodes, spleen,

brain, adrenal glands, stomach, large and small in-

testines, skin, skeletal muscles, thyroid gland, salivary

glands, eyes, and reproductive organs.

Organ samples were fixed in a 10% formalin (and

in some cases, zinc formalin, Champy’s, Carnoy’s, and

Bouin’s mixtures), dehydrated in a 99.7% isopropa-

nol (Biovitrum, Russia), and embedded in a paraffin

(Biovitrum), followed by staining with hematoxylin

and eosin using a routine protocol [18]. Microscopic

examination was performed using an AxioScope  A1

microscope (Carl Zeiss, Germany), and microphoto-

graphs were taken with an MRc.5 camera (Carl Zeiss).

Identified changes were classified according to

the criteria accepted in the pathology of laboratory

animals [19-22].

Histochemical examination. Paraffin sections

(3  µm) were examined unstained using a fluorescence

microscope with a FITC filter (excitation at 493  nm),

stained with Sudan IV, Schmorl’s method (for lipo-

fuscin), Giemsa, PAS, Warthin–Starry (for bacteria),

Van Gieson (for collagen), Altman (for mitochondria),

Lepehne–Pickworth (for hemoglobin), Landrum (for

intracellular protein granules), Stein, Fouchet (for

bilirubin), and Perl’s method (for hemosiderin) us-

ing routine protocols [18]. Additionally, immunohis-

tochemical examination of the brain was performed

using rabbit monoclonal antibodies against beta-amy-

loid (ab201060; Abcam, USA; dilution 1  :  1000), using

standard immunoperoxidase techniques on paraffin

sections after heat-induced epitope retrieval in a ci-

trate buffer (pH  6.0), with a detection system (Cell

Margue, USA) and appropriate positive and negative

controls.

For score assessment of changes, the following

criteria were used: hepatic lipofuscinosis (0 – none,

1 – pigment visible in individual hepatocytes, 2 – pig-

ment present in most hepatocytes in the perinuclear

zone, 3 – pigment present in all hepatocytes); fatty

degeneration (0 – none, 1 – fatty degeneration in indi-

vidual cells, 2 – involvement of up to 50% of hepato-

cytes, 3 – involvement of more than 50% of hepato-

cytes); myocardial degeneration (0 – none, 1 – single

foci, 2 – multiple foci, 3 – total involvement); cataract

(0 – none, 1 – single subcapsular foci, 2 – involve-

ment of less than 50% of the lens, 3 – involvement of

more than 50% of the lens); amyloid deposits in the

thalamus (0 – none, 1 – single deposits per section,

2 – single deposits in each 1000× microscope field, 3–

multiple deposits in each field); renal lipofuscinosis

(0 – none, 1 – present in individual tubules, 2 – in-

volvement of up to 50% of tubules, 3 – involvement

of more than 50% of tubules).

Electron microscopy. Samples of liver and

kidney tissues were taken for electron microsco-

py. Tissue samples (0.5×0.5×1  mm) were fixed in a

MANSKIKH et al.1972

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

Table 1. Gene-specific primers for autophagy marker genes and the reference gene

Gene Forward primer; Tm (°C) Reverse primer; Tm (°C)

p62 GCTGTCTGCCCTGTTTTCAT; 58.75 GGCCCAAGTGCTATTCACAG; 58.90

LC3b AAGAGTGGAAGACGTTCGGC; 60.32 GGTTTTATCCAGGACGGGCA; 60.03

ATG14 AAGCAGAGAGGCAAACTCCC; 59.96 TGTGATCAGCTCTTGGGAACT; 59.02

ATG9a TGCATGCTCTACGAATCCCC; 59.89 GAAACAGAGAGCCAGGTCCC; 60.04

GAPDH TGGCAAGGTGGATATCGTGG; 59.82 CTTCTCGTGGTTCACACCCA; 59.89

Note. Tm, melting temperature.

2.5% glutaraldehyde (Sigma, USA) in a cacodylate

buffer, post-fixed in 1% OsO

(EMS, USA), dehydrat-

ed in ethanol and acetone, and embedded in SPI-Pon

812 (Structure Probe, Inc., USA). Ultrathin sec-

tions were made using a diamond knife (DiATOME,

USA) and mounted on copper slot grids (Ted Pella,

USA). Sections were stained with uranyl acetate and

lead nitrate and examined using a JEM 1400 elec-

tron microscope (JEOL, Japan) at accelerating voltage

of 80 kV.

Gene expression analysis of autophagy mark-

ers. Liver tissue samples obtained at necropsy (n = 6

for both cachexic and control animals) were mechan-

ically homogenized in liquid nitrogen and lysed in an

ExtractRNA reagent (Evrogen, Russia). Total RNA was

isolated using a standard method with a guanidine

thiocyanate/phenol/chloroform mixture. RNA con-

centration was determined using a NanoPhotometer

(Implen, Munich, Germany) at 260/240 nm. Reverse

transcription was performed using a RevertAid First

Strand cDNA Synthesis Kit (Thermo Scientific, USA).

Quantitative reverse transcription PCR (RT-qPCR)

was performed in real-time using a qPCRmix-HS

SYBR+LowROX (5X) kit (Evrogen) with gene-specific

primers (Evrogen) (Table 1). Primers were selected

using the Primer Blast service (https://www.ncbi.nlm.

nih.gov/tools/primer-blast/). Primer validation was

performed by matching melting temperature (Tm)

with the calculated value (provided in Table 1). For

negative control, RNA isolated from Escherichia coli

after reverse transcription was used as a template,

as described above. Amplification and detection were

performed using a DT Prime 4 amplifier (DNA-Tech-

nology, Russia). For all primers, absence of DNA

contamination in the isolated RNA samples was con-

firmed by performing amplification without reverse

transcription under the described conditions and

parameters. No DNA contamination was detected in

the samples. Gene expression analysis was performed

using the 2

−ΔΔCt

method, with GAPDH as the reference

gene. Results were normalized to the average expres-

sion level of GAPDH.

Electrophoresis and Western blot analysis.

Electrophoresis in 12% polyacrylamide gel was per-

formed using a routine method with minor modifica-

tions described previously [23]. Liver tissue fragments

obtained at necropsy (n = 3 for both cachexic and

control animals) were lysed in a buffer containing:

150 mM NaCl, 50 mM Tris-HCl (pH 8.0), 0.5% Nonidet

P-40, 1% sodium deoxycholate, 0.5% sodium dodecyl

sulfate, and protease inhibitors (Thermo Fisher Sci-

entific, USA). After separation (30 µg of protein per

lane), proteins were electrophoretically transferred to

a nitrocellulose membrane (Bio-Rad, USA) and incu-

bated with diluted antibodies using a routine meth-

od. Primary antibodies included rabbit monoclonal

antibodies against mouse proteins ATG14 (ab315009;

dilution 1  :  1000), ATG9a (ab108338; dilution 1  :  1000),

and rabbit polyclonal antibodies against mouse pro-

teins p62 (ab91526; concentration 1  µg/mL) [24, 25]

and housekeeping protein beta-actin (ab8227; dilution

1  :  2000) [26], obtained from Abcam; and antibodies

against LC3b (Cell Signaling, USA; #2775; dilution

1  :  1000) [25]. Dilution was performed as recom-

mended by the manufacturers in a buffer containing

150  mM NaCl, 50mM Tris-HCl (pH 7.5), 0.1% Tween  20,

and 1% bovine serum albumin. Secondary antibodies,

conjugated with horseradish peroxidase and specific

to rabbit antibodies, were diluted in the same buffer

at a ratio of 1  :  20,000 according to the manufactur-

er’s recommendations (ab6721; Abcam). Luminescent

signal was visualized using a Novex ECL kit (Invitro-

gen, USA) and a ChemiDoc scanner (Bio-Rad). Due to

the lack of commercially available antibodies against

Heterocephalus glaber proteins, validation of anti-

bodies against ATG14 and ATG9a, used for the first

time, was performed by aligning the peptide antigen

sequences used by the companies to produce antibod-

ies against the protein sequences of the naked mole

rat, obtained using the online services at https://

www.uniprot.org/ and the database at http://naked-

mole-rat.org/annotations/details/XP_004871135.1/

and http://naked-mole-rat.org/annotations/details/

XP_004864595.1/ for ATG14 and ATG9a, respectively.

PROGEROID SYNDROME 1973

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

In all cases, suitability of the antibodies for the naked

mole rat was established by the presence of a single

specifically stained band corresponding to the molec-

ular weight and mobility of the protein under study.

Protein concentration determination. Protein

concentration in the samples for Western blot analy-

sis was determined using bicinchoninic acid and

bovine serum albumin as a standard, following the

manufacturer’s recommendations (Pierce, USA).

Statistical analysis. Data analysis was performed

using GraphPad Prism 8. Data were first tested for

Gaussian distribution using the D’Agostino & Pearson

omnibus normality test, then analyzed using Student’s

t-test, Mann–Whitney test, or one-way ANOVA. Results

are presented as a mean ± standard deviation (SD).

Differences were considered significant at p < 0.05.

RESULTS

Clinical characteristics of the disease. Clinical

manifestations of the disease have been described in

detail previously [17]. In all cases, the affected ani-

mals were worker individuals. Visually, the animals

appeared severely emaciated, with sunken flanks

and a pointed snout, resembling appearance of the

30-year-old naked mole rats [9]. Objective examina-

tion of animals with signs of cachexia revealed a 15%

reduction in the body mass index compared to the

control animals from the same colony [17]. Despite

this, they exhibited the same feeding behavior as

other animals. Immediately before death, the animals

displayed neurological symptoms, including stupor or

ataxia with rolling onto their backs when attempting

to move.

All animals exhibited similar changes, although

to varying degrees. At necropsy, signs of cachexia and

complete absence of visible fat deposits were noted.

The liver was typically dark brown, and a light-yel-

low transparent fluid (ascites) had accumulated in

the abdominal cavity. The kidneys were pale yellow.

Other organs were proportionally reduced in size but

without visible pathological changes.

Histopathological analysis results. Microphoto-

graphs showing structure of the organs in the healthy

control naked mole rats, for comparison with the

pathologically altered organs, are provided in Fig.  1

due to the rarity of this animal.

Liver. The most severe changes in the affect-

ed animals were found in the liver and have been

partially described previously [17]. Despite the over-

all preservation of organ architecture (no signs of

lobule deformation or fibrosis), significant changes

were observed in hepatocytes and stromal cells. The

cytoplasm of hepatocytes contained a large number

of light-brown pigment granules that, when treated

with osmium tetroxide (Champy’s fixation), stained

intensely black-brown, green with Giemsa, exhibited

strong autofluorescence in paraffin sections, stained

weakly with Sudan IV and PAS, did not give a pos-

itive Perl’s reaction for iron or a reaction for bili-

rubin, but stained blue-green with Schmorl’s meth-

od (Fig. 2, a-d). These histochemical properties are

characteristic of the “aging pigment” (lipofuscin)[27].

Large amounts of this pigment accumulate in the peri-

nuclear region of cells, which become hypertrophied,

binucleated, and have markedly enlarged nucleoli.

Hypertrophy of the cells is always localized in the

periportal zone of the lobules. In the hypertrophied

cells, along with lipofuscin, numerous eosinophilic

granules are visible, which stain red with Altman’s

method (after Champy’s fixation), characteristic of mi-

tochondria; and both pigment and mitochondria are

concentrated in the perinuclear zone (Fig. 2d). When

stained with Lepehne–Pickworth and Landrum, the

phagocytosed erythrocytes were occasionally visible

in the cytoplasm of individual hypertrophied he-

patocytes (Fig. 2e). Some liver cells, on the contrary,

undergo atrophy and fatty degeneration with accu-

mulation of large lipid droplets (stained black after

fixation with Champy’s mixture with OsO

). Among

the hypertrophied hepatocytes, foci of extramedul-

lary hematopoiesis, unusual for the liver of the naked

mole rat, are sometimes observed. Kupffer cells (liv-

er macrophages) show strong accumulation of hemo-

siderin (giving a positive reaction for trivalent iron

with Perl’s method), reaching a degree characteristic

of hemochromatosis (Fig.  2f). These changes were not

observed in the animals without signs of cachexia; a

species-specific feature of hepatocytes in the healthy

naked mole rats is optically clear cytoplasm, due to

their high glycogen content (Fig.  1a).

Kidneys. In the kidneys, in addition to calcium

phosphate deposits characteristic of all naked mole

rats (including those without signs of disease), intra-

cellular deposits of lipofuscin, numerous small lipid

droplets in the cells of the proximal tubules, and he-

mosiderin in the individual tubules were found (Fig.  3,

a andb). The renal glomeruli were unchanged. These

changes were not found in the kidneys of healthy an-

imals (Fig. 1b).

Heart. Changes in the heart included severe vac-

uolar degeneration and atrophy of cardiomyocytes in

the walls of both ventricles (Fig.  3c), as well as ac-

cumulation of a small amount of brown pigment in

the individual cardiomyocytes, similar to that found

in hepatocytes. The myocardium of healthy animals

showed no changes (Fig. 1c).

Eyes. The examined animals exhibited previous-

ly undescribed eye lesions. These appeared as typi-

cal degeneration of peripheral lens fibers with swell-

ing, clearing, and formation of Morgagnian spheres,

MANSKIKH et al.1974

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

Fig. 1. Histological appearance of internal organs in healthy naked mole rats. a) Liver; b) kidney; c) myocardium; d) eye

lens; e) cerebellum; f) thalamus. Staining methods: a-d) hematoxylin and eosin; e) PAS (with hematoxylin counterstain);

f)Immunoperoxidase reaction with antibodies against beta-amyloid with PAS and hematoxylin counterstain. Scale bars and

magnifications: a, b, e, f) 40 µm, 1000×; c, d) 100 µm, 400×.

characteristic of cataracts (Fig.3d), but not in the eyes

of intact naked mole rats (Fig.1d). The retina, choroid,

cornea, and other eye structures were unchanged.

Brain. Significant changes were found in the

brain. The PAS-positive pigment inclusions, similar to

those in hepatocytes, were detected in the neurons